... report Ali AM Ghazi 1 , Hamid Attarian 2 , Shirin Attarian 2* , Abolghasem Abasahl 3 , Ebrahim Daryani 4 , Ebrahim Farasat 5 , Marina Pourafkari 6 , Farrokh Tirgari 7 , Siavash M Ghazi 1 , Kalman ... hypercalcemia in a B-cell type malignant lymphoma. Internal Medicine 1992, 31:968-972. 10. Hanihara T, Takahashi T: Parathyroid hormone-related protein-associated hypercalcemia in probable intr...
Ngày tải lên: 11/08/2014, 02:21
... ALS and PHP, however. Patients with PHP often have stocking-glove loss of pain and vibratory sensation as well as parathesias [25]. Patients with PHP mayalsohaveassociated ataxia, decreased arm ... 4:298 http://www.jmedicalcasereports.com/content/4/1/298 Page 3 of 7 Acknowledgements We are grateful to Richy Agajanian for his hematological advice on the manuscript. This case was presente...
Ngày tải lên: 11/08/2014, 02:21
báo cáo khoa học: "A rare midbrain infarction presenting with plusminus lid syndrome with ataxia: a case report" potx
... Assoc Physicians India 2005, 53:908-909. 4. Galetta SL, Gray LG, Raps EC, Grossman RI, Schatz NJ: Unilateral ptosis and contralateral eyelid retraction from a thalamic -midbrain infarction. Magnetic ... those having evidence of infarction on a repeat MRI scan. Most such lesions were lacunar and in the brainstem [5]. Conclusions Plus-minus lid syndrome with ataxia is a rare...
Ngày tải lên: 10/08/2014, 23:20
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt
... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-binding proteins. Database Structural data for the two RNase A complexes are available in the Protein Data Bank ... surrogates. Experimental procedures A fluorogenic RNase substrate, 6-FAM–dArUdAdA– 6-TAMRA (where 6-FAM is a 6-carboxyfluorescein group at the 5¢-end and 6-TAMRA is a 6-carboxytetrame...
Ngày tải lên: 14/02/2014, 22:20
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc
... phytate with pH optima in the acidic range. They consist of two domains, a large a ⁄ b domain and a small a domain with the catalytic site at the interface of the two domains [4,5]. HAPs can initi- ate ... glucose- 1-phosphatase and human prostatic-acid phosphatase. The polypeptide chain is organized into an a and an a ⁄ b domain, and the active site is located in a positive...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt
... number gi:91782944) was amplified from genomic DNA of B. xenovo- rans LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse ... by calculating the Ramachandran plot with the program sirius (San Diego Supercomputer Center, San Diego, CA, USA). Metal analysis This was performed with an inductively coupled plasm...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Four divergent Arabidopsis ethylene-responsive element-binding factor domains bind to a target DNA motif with a universal CG step core recognition and different flanking bases preference pptx
... DNA-binding site A 60 bp single-stranded DNA RDM10, with 10 random- ized oligonucleotides in the center, i.e. CTGTCAGTGAT GCATATGAACGAATN 10 AATCAACGACATTAGGATC CTTAGC was synthesized. A 100 ng sample of ... 701–713. 15 Prabakaran P, An J, Gromiha M, Selvaraj S, Uedaira H, Kono H & Sarai A (2001) Thermodynamic database for protein-nucleic acid interactions (ProNIT). Bioinfor- mati...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Progress for dengue virus diseases Towards the NS2B–NS3pro inhibition for a therapeutic-based approach ppt
... processing and RNA replication. The NS3 protein (69 kDa) is a multifunctional protein with an N-terminal protease domain (NS3pro) (1–180), an RNA triphosphatase, an RNA helicase and an RNA- stimulated ... disease plays a key role in inducing plasma leakage, shock and hemorrhagic manifestations. Currently, there are no vaccines available against dengue virus, although several tetravalent...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Báo cáo khoa học: Models and mechanisms of O-O bond activation by cytochrome P450 A critical assessment of the potential role of multiple active intermediates in oxidative catalysis doc
... Mukai, M., Kitagawa, T., Jitsukawa, K., Masuda, H. & Einaga, H. (1999) Synthesis and characterization of novel alkylperoxo m ononuclear i ron(III) complexes with a tripodal pyridylamine ligand: ... J.N., Corina, D. & Akhtar, M. (1996) The mechanism o f the a cyl-carbon bond cleavage re action catalyzed by recombinant sterol 1 4a- demethylase of Candida albicans. (other names are...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... pGL3e:Prm 3a AP)1 *, pGL3b:Prm3ab AP)1 *, pGL3e: Prm3ab AP)1 *, pGL3b: Prm3aa AP)1 *, pGL3e:Prm3aa AP)1 *, pGL3b:Prm3aaa AP)1 * and pGL3e:Prm3aaa AP)1 *. Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa ... to aaTTCCa (core bases shown in uppercase letters) centered at )123 within Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAAT...
Ngày tải lên: 19/02/2014, 16:20