báo cáo khoa học: "Triple malignancy in a single patient including a cervical carcinoma, a basal cell carcinoma of the skin and a neuroendocrine carcinoma from an unknown primary site: A case report and review of the literature" ppt

... et al.: Triple malignancy in a single patient including a cervical carcinoma, a basal cell carcinoma of the skin and a neuroendocrine carcinoma from an unknown primary site: A case report and review ... already reported a case of four malignancies in the same patient including a c ervical carcinoma and a basal...

Ngày tải lên: 10/08/2014, 23:20

... contributions AD was involved in writing and editing the final manuscript. VAS was the Orthopaedic Oncologist who treated and planned the management of the patient and was involved in critical appraisal of ... blood transfusion: case report Amreeta Dhanoa 1* , Vivek A Singh 2 , Rukmanikanthan Shanmugam 2 , Raja Rajendram 3 Abstract We describe an unusual case...

Ngày tải lên: 09/08/2014, 03:22

... transgenic plants via Agrobacterium-mediated transformation in the Liliaceous ornamentals was affected by several factors such as, target material for Agrobacterium inoculation, kind of Agrobacterium ... transgene copy number and the activity of transgene expression in the transformed materials. In the future, the methodology for lily transformation from other...

Ngày tải lên: 06/08/2014, 19:20

... within the fusion proteins, we calculated the theoretical average spectra of equimolar IDP and GFP mixtures by averaging the spectra of the individual IDP and GFP proteins. Note that each average ... (5¢-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3¢) designed to introduce a hexahistidine tag and a ClaI restriction site at nucleotide position –6 and a re...

Ngày tải lên: 18/02/2014, 04:20

... activates adenylate cyclase (CyaA) and leads to an increase in the intra- cellular cyclic AMP (cAMP) level [1]. Mathematical models of catabolite repression in E. coli The (isolated) reactions of the ... intra- cellular metabolites. An approach that combines flux balance analysis (FBA) with an ordinary differential equation (o.d.e.) model of the slow time scales is ca...

Ngày tải lên: 18/02/2014, 13:20

... universal cell- signalling cascades including MAPK and phosphatidylinositol 3-kinase (PI3K) pathways that can target HtrA2, PINK1, Parkin and DJ-1. Likely these PD-associated proteins are part of a complex network ... kinases including casein kinase 1, protein kinase A, protein kinase C [86] and cyclin-dependant kinase 5 [87]. Phos- phorylation of Parkin by CDK5 may regulat...

Ngày tải lên: 18/02/2014, 14:20

... organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain Thirumaran Thanabalu 1,2 , Rajamuthiah Rajmohan 2 , Lei Meng 2 , Gang Ren 4,5 , Parimala R. ... polyclonal GFP-spe- cific antiserum was a gift from J. Kahana and P. Silver (Dana Farber Cancer Center, Boston, MA). The anti-actin mAb was MAB1501 from Chemicon International (...

Ngày tải lên: 18/02/2014, 16:20

... comparisons of i) Sarcastic and Non-Sarcastic (S- NS); ii) Sarcastic and Positive (S-P) and Sarcastic and Negative (S-N). The NS tweets were obtained by merging 450 randomly selected positive and 450 ... Analysis and Opinion Mining, in 'Proceedings of the Seventh conference on Interna- tional Language Resources and Evaluation (LREC'10)' , European L...

Ngày tải lên: 20/02/2014, 05:20

... in a single comparison. Thus, using the full comple- ment of adjectival properties used by Veale and Hao (2007), we harvest all instances of the patterns “as ADJ and * as” and “as * and ADJ as” ... larger body of resonant combinations than the average human. The necessary barrage of linguistic stimuli can be provided by the Google 1T database of Web ngrams (B...

Ngày tải lên: 20/02/2014, 05:20

... remarkable at first glance. However, recall that the human raters had an average of 56% agreement on story ratings, and in that light the Naive Bayes learner approaches the performance of human ... via automatic event extraction can be used in both natural language understanding and advice generation in the domain of narrative in- struction. The background applica...

Ngày tải lên: 20/02/2014, 12:20