0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: "Angiofibroma of the spermatic cord: a case report and a review of the literature" potx

Báo cáo khoa học:

Báo cáo khoa học: "Gamma Knife radiosurgery for vestibular schwannoma: case report and review of the literature" pptx

... This case highlights an atypicalpresentation of vestibular schwannoma, associated with audible "clicks" and normal hearing. Wealso provide a concise review of the available literature ... CentralPage 1 of 6(page number not for citation purposes)World Journal of Surgical OncologyOpen Access Case report Gamma Knife radiosurgery for vestibular schwannoma: case report and review of ... facial nerve damage, and other complications. A radiation oncologist discussed the risks and benefits of Gamma Knife treatment, including reported recurrencerates and hearing preservation rates....
  • 6
  • 407
  • 0
báo cáo khoa học:

báo cáo khoa học: "Metastatic ameloblastoma responding to combination chemotherapy: case report and review of the literature" pptx

... ameloblasticcarcinomas are histologically malignant in both primary and metastatic sites. Case presentation: A 24-year-old Moroccan man presented a malignant ameloblastoma of the mandible. The tumor ... classific ation, a distinction wasmade between ameloblastoma, malignant ameloblastoma and ameloblastic carcinoma [2]. Malignant ameloblastomadiffers from ameloblastoma due to the presence of ... When metastases are removable, surgery is the treatment of choice. Results of radiotherapy and/ or che-motherapy are unpredictable and the data are poor. Lessthan 50 cases were reported and conclusions...
  • 5
  • 387
  • 0
Báo cáo khoa học: Nop53p interacts with 5.8S rRNA co-transcriptionally, and regulates processing of pre-rRNA by the exosome ppt

Báo cáo khoa học: Nop53p interacts with 5.8S rRNA co-transcriptionally, and regulates processing of pre-rRNA by the exosome ppt

... study18SRevPE AATTCAGGGAGGTAGTGACA [26]SnR37For CCGATTGGCAAAAAC This studySnR37Rev TGTTGGAGCACAAGCAAG This studySnR74For GCTGCAGAAGATGAAACAA This studySnR74Rev GCATCAGACACTAATTGC This studyCr.V ... GGAAATGCGTAGGGAAGACCAATTTCATGACGThis studyCr.V interg. Rev GATGCCTCTTTAGAACAAGGTTACAAATCCTGThis study5.8SFor2865 CTTTCAACAACGGATCTCTTGG [31]5S GGTCACCCACTACACTACTCGG [31]scR1Rev TCTAGCCGCGAGGAAGGA ... CTCACTACCAAACAGAATGTTTGAGAAGG[16]P7 GCCGCTTCACTCGCCGTTACTAAGGC[26]25SFor3252 GTTTGACCTCAAATCAGGTAGG This study25SRev3501 CTCTTCGAAGGCACTTTACA This study18SFor701 TATCTGGTTGATCCTGCCAG...
  • 15
  • 380
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Primary carcinoid tumor of the gallbladder: A case report and brief review of the literature" potx

... Tanaka T, Tsuchiya S, Miura M, Saigusa N, Yanagisawa S,Takeuchi O, Kitakata Y, Saito H, Shimizu A, Miyazaki M: A case of classicalcarcinoid tumor of the gallbladder: review of the Japanese publishedworks. ... gallbladder have neither a metastatic nor invasive char-acter and exhibit a more propitious prognosis. The “aty-pical” variant s, however, are associated with marked cellatypia and mitosis, ... M: A 5-decade analysis of 13,715 carcinoidtumors. Cancer 2003, 97:934-959.16. Soga J: Primary endocrinomas (carcinoids and variant neoplasms) of the gallbladder. A statistical evaluation of...
  • 8
  • 442
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A rare coexistence of adrenal cavernous hemangioma with extramedullar hemopoietic tissue: a case report and brief review of the literature" docx

... removal of adrenal haemangioma after five years of follow-up: a case report. Hinyokika Kiyo 1998, 44:579-581.6. Hisham AN, Samad SA, Sharifah NA: Huge adrenal haemangi-oma. Austral Radiol 1998, ... Simultaneous occurrence of a cav-ernous adrenal gland haemangioma and a bile duct-liver car-cinoma. Rofo 1980, 132(4):460-462.15. Yamada T, Ishibashi T, Saito H, Majima K, Tsuda M, Takahashi ... participated in the acquisition of data and prepara-tion of the manuscript. VS was the surgeon, approved the final version of the manuscript for publication. AKP per-formed histopathological and immunohistochemicalanalysis...
  • 4
  • 234
  • 0
Báo cáo khoa hoc:

Báo cáo khoa hoc:" Complicated Crohn''''s-like colitis, associated with Hermansky-Pudlak syndrome, treated with Infliximab: a case report and brief review of the literature" pot

... design of the study, the acquisition and interpretation of data and drafted the manuscript. MSP participated in the sequencealignment and reviewed the literature. EP participated in the sequence alignment ... improvement of her colitis, as seen on repeat colonoscopy, (Figures 3 and 4) and healing of the fistula.On a maintenance regimen of AZA 100 mg/daily and a dose of infliximab 5 mg/Kg/8 wk the patient has ... patient had perianal disease with inflam-mation and fistula, a complication characteristic of Crohn's disease that has been previously described bySherman et al in 1989 [8] and by Hazzan...
  • 7
  • 380
  • 0
báo cáo khoa học:

báo cáo khoa học:" Traumatic bone cyst of the mandible of possible iatrogenic origin: a case report and brief review of the literature" ppsx

... the trauma was a striking feature in most of the cases and that this finding suggests that trauma may play a part in the causation of at least a proportion of the TBCs.In some case reports of TBCs, ... dental canal[2] and pathologic fracture of the mandible [20]. Expansion of the cortical plate of the jawbone is often noted, usually buccally, resulting inintraoral and extraoral swelling and ... condyle and the infratem-poral region. Oral Maxillofac Surg 2004, 62:996-1001.35. Ogasawara T, Kitagawa Y, Ogawa T, Yamada T, Yamamoto S, HayashiK: Simple bone cyst of the mandibular condyle...
  • 5
  • 363
  • 0
Báo cáo y học:

Báo cáo y học: "ronchogenic cyst associated with pericardial defect: Case report and review of the literature." pptx

... cyst associated with pericardialdefect: Case report and review of the literatureAndrea Imperatori1, Nicola Rotolo1, Elisa Nardecchia1, Giovanni Mariscalco2, Marco Spagnoletti1 and Lorenzo ... rupture,hemoptysis, and malignant changes [4-7].BC have been reported to be also associated withother congenital malformations, including cardiac and pericardial anomalies [8-21]. Partial or total pericardialdefect ... cyst associated withpericardial defect: Case report and review of the literature. Journal of Cardiothoracic Surgery 2011 6:85.Submit your next manuscript to BioMed Central and take full advantage...
  • 5
  • 399
  • 0
báo cáo khoa học:

báo cáo khoa học: "Recombinant immunotoxin anti-c-Met/PE38KDEL inhibits proliferation and promotes apoptosis of gastric cancer cells" docx

... FZQ:Contributed to the design and coordination of the study and aided withmanuscript preparation. All authors read and approved the final manuscript.Competing interests The authors declare that they have ... soft-ware. Data were presented as mean ± standard devia-tion. Student’s t-test was used to compare two samples, and the single -factor analysis of variance (One-wayANOVA) was used to compare ... Zhonghua Zhong Liu Za Zhi1999, 21:409-411.14. Koyama M, Izutani Y, Goda AE, Matsui TA, Horinaka M, Tomosugi M,Fujiwara J, Nakamura Y, Wakada M, Yogosawa S, Sowa Y, Sakai T: Histonedeacetylase...
  • 7
  • 288
  • 0
báo cáo khoa học:

báo cáo khoa học: "Factors influencing success in quality-improvement collaboratives: development and psychometric testing of an instrument" pdf

... data (includingstatistical reports and tables) in the study and take responsibility for the integrity of the data and the accuracy of the data analysis. All authors read and approved the final ... performed the statistical analysis. MEJHH and RPTMG conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors had full access to all of the ... differentorganisations and agencies that share a commitment tomaking small, rapid tests of change that can be expandedto produce breakthrough resultsinaspecificclinicaloroperational area [1]. Although...
  • 9
  • 444
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP