báo cáo khoa học: "Individualized therapies in colorectal cancer: KRAS as a marker for response to EGFR-targeted therapy" docx
... metastatic colorectal cancer. KRAS and skin rash are independent predictive markers for response to EGFR-targeted monoclonal antibody therapies Long before KRAS emerged as a predictive marker ... extracellular domain has the ligand binding site and also contains specific sequences that are involved in dimerization, while the intracellular domain is a catalytic site t...
Ngày tải lên: 10/08/2014, 22:20
... treat- ment failure of tyrosine kinase inhibitors. Everolimus was also evaluated in combination therapy with sorafenib in a phase I study as well as with bevacizu- mab in a phase II study at ASCO ... October 16, 2007 it was approved for the treatment of metastatic, refractory breast cancers in combination with capecitabine. A phase II study was presented at ASCO 2008 inves...
Ngày tải lên: 10/08/2014, 22:20
... Toxicity Evaluation at ASCO Lapatinib EGFR/HER2 Diarrhea, rash, nausea, vomiting -monotherapy in inflammatory BC -c/w trastuzumab -c/w bevacizumab HKI-272 Pan HER Diarrhea, nausea n /a Trastuzumab DM-1 ... currently reached accrual and is awaiting data analysis.[11] It is also currently being evaluated in phase I/II studies in combina- tion with paclitaxel as well as in combinati...
Ngày tải lên: 10/08/2014, 22:20
báo cáo khoa học: " Transcriptome instability in colorectal cancer identified by exon microarray analyses: Associations with splicing factor expression levels and patient survival" docx
... corresponds approximately to one exon, and will be referred to as such herein. The arrays were finally washed, stained and scanned according to the manufacturer’s protocol. Data analysis Scanning of ... CRC samples, in the same manner as for the splicing factor genes. Results Variation in the amounts of aberrant alternative exon usage among colorectal cancer tissue samples E...
Ngày tải lên: 11/08/2014, 12:21
Báo cáo khoa học: "Young patients with colorectal cancer have poor survival in the first twenty months after operation and predictable survival in the medium and long-term: Analysis of survival and prognostic markers" pot
... physical examination, including digital rectal examination and CEA level every three months. A chest radiograph and trans-abdominal ultrasound scan or computerized tomogram was undertaken at one ... patients with colorectal cancer were compared with forty seven patients from the same database, over 50 years old, in whom all comparable data were available (Table 1). Again, consecutive sa...
Ngày tải lên: 09/08/2014, 03:22
Báo cáo khoa học: "Extracorporeal therapies in acute rhabdomyolysis and myoglobin clearance" ppsx
... removal of circulating myoglobin. In a recent paper, Naka and colleagues have proposed the use of a super-high-flux membrane in continuous hemofiltration. The removal of myoglobin was greater than ... Naka and colleagues concluded an interesting study on myoglobin clearance by hemofiltration using a ‘super-high-flux’ membrane in a case of acute rhabdomyolysis [2]. The paper is o...
Ngày tải lên: 12/08/2014, 22:21
Tài liệu Báo cáo khoa học: Brain angiogenesis in developmental and pathological processes: neurovascular injury and angiogenic recovery after stroke docx
... stroke, because glutamate-induced excitotoxicity has been thought of as the main reason for neuronal cell death. Although NMDA receptor activation in the acute phase leads to neuronal damage, the same ... dysregulation of neurovascular pro- teases has been implicated as central in neurovascular injury after stroke. In particular, the matrix metallo- proteinase (MMP) family of ex...
Ngày tải lên: 18/02/2014, 11:20
Tài liệu Báo cáo khoa học: Antioxidant defences in cybrids harboring mtDNA mutations associated with Leber’s hereditary optic neuropathy docx
... cybrids in gal-DMEM. In contrast, GSH markedly increased in cells carrying the 3460 ⁄ ND1 and 11778 ⁄ ND4 mutations, which once again showed similar behavior. A 12-h incubation in galactose caused a ... proteinÆmin )1 . Total catalase activity was assayed by the method of Aebi [45]. Activity was measured by monitoring, for 30 s at 25 °C, the decomposition of 10 mm H 2 O 2 at 240...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Trophoblast-like human choriocarcinoma cells serve as a suitable in vitro model for selective cholesteryl ester uptake from high density lipoproteins pdf
... is a malignant neoplasm that represents the early trophoblast of the attachment phase or as later invasive stage [46–48]. Thus, in most cases, choriocarcinoma has the appearance of trophoblast, ... 39, 495–508. 17. Alsat, E. & Malassine, A. (1991) High density lipoprotein inter- action with human placenta: biochemical and ultrastructural characterization of binding to microvillou...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... ACAGCAAAAAGGAGGCCAAA 138 BMP2 CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83 MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT 259 CD237904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92 AL707095 ... 92 AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG 128 AK095731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC 109 DKK1 CACCTTGGATGGGTATTCCA CAACACAATCCTGAGGCACA 114 BC037851 CACAGCTCCCATTCATTCC...
Ngày tải lên: 06/03/2014, 22:21