báo cáo khoa học: "SMI of Bcl-2 TW-37 is active across a spectrum of B-cell tumors irrespective of their proliferative and differentiation status" pptx
báo cáo khoa học: "SMI of Bcl-2 TW-37 is active across a spectrum of B-cell tumors irrespective of their proliferative and differentiation status" pptx
... active across a spectrum of B-cell tumors irrespective of their proliferative and differentiation status Ayad M Al-Katib*, Yuan Sun, Anton Scott Goustin, Asfar Sohail Azmi, Ben Chen, Amro Aboukameel ... T/C Cleavage of caspase 9, 3 and PARP protein and induction of Caspase 3, 9 activity and resulting DNA fragmentation in TW-37 treated lymphoid cell lines...
Ngày tải lên: 10/08/2014, 22:20
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... discuss the consequences of variation and bias in relation to monitoring of animal disease incidence on herd and national level, causal analysis on national level, as well as estimation of validated ... veterinarian's perception of the specific farm and by his or her evaluation of the local context. That is, treatment data as an indicator of a certain disease manifes...
Ngày tải lên: 25/10/2012, 10:45
Báo cáo khoa học: Plant oxylipins: Plant responses to 12-oxo-phytodienoic acid are governed by its specific structural and functional properties ppt
... members of the Brassicaceae. Recently, we were able to detect lipid- bound cyclic oxylipins in Arabidopsis arenosa, Arabid- opsis halleri, Arabidopsis petraea, Arabidopsis thaliana, Arabis pendula, ... Yang W, Devaiah SP, Pan X, Isaac G, Welti R & Wang X (2007) AtPLAI is an acyl hydrolase involved in basal jasmonic acid production and Arabidopsis resistance to Botrytis cinerea. J Bi...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: The equinatoxin N-terminus is transferred across planar lipid membranes and helps to stabilize the transmembrane pore pot
... transferred across planar lipid membranes and helps to stabilize the transmembrane pore Katarina Kristan 1 , Gabriella Viero 2 , Peter Mac ˘ ek 1 , Mauro Dalla Serra 2 and Gregor Anderluh 1 1 Department ... ME & Lissi EA (2003) Comparison of pore-forming ability in membranes of a native and a recombinant variant of sticholysin II from Stichodactyla helianthus. Toxicon 42...
Ngày tải lên: 23/03/2014, 10:20
Báo cáo khoa học: "Optimization in Coreference Resolution Is Not Needed: A Nearly-Optimal Algorithm with Intensional Constraints" ppt
... sentences and markables - part of speech of the head of the markables - the grammatical functions - parallelism of grammatical functions - do the heads match or not - where is the pronoun (if any): ... (pronominal anaphora) and (Versley, 2006) (nominal anaphora). Common to all ILP approaches (incl. ours) is that they apply ILP on the output of pairwise machine-learning. Deni...
Ngày tải lên: 31/03/2014, 20:20
Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt
... exchange columns (Amersham Bio- sciences ⁄ GE Healthcare, Piscataway, NJ, USA), superfine G-25 Sephadex (Pharmacia ⁄ Pfizer, Oakville, ON, Canada) and a stirred ultrafiltration cell (Amicon Bioseparations ... spectra were acquired on a Cary 5G UV-Vis-NIR spectrophotometer (Varian Canada Inc., Mississauga, ON, Canada) in a 1 cm quartz cuvette at room temperature (22 °C) and recorded usi...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Báo cáo khóa học: The unusual methanogenic seryl-tRNA synthetase recognizes tRNASer species from all three kingdoms of life pptx
... conserved core of modifications observed in tRNAs of almost all organisms [44] archaea, bacteria and eukarya each make phylogenetically character- istic modifications to their tRNAs following transcription, which ... in animal mitochondria. While bacteria and organelles contain three isoacceptor families comprising long variable arms (type 2 tRNAs; tRNA Ser ,tRNA Leu and tRNA Tyr ),...
Ngày tải lên: 19/02/2014, 12:20
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot
... inverted terminal repeat amplification were: 1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGC ATGGC-3¢; and AAV65MGB/taq, 5¢-GTTAATGATT Table 1. Primers and probe sets ... CGCTTTCGGAGGTGCTTTCGCAG M1941p65.R: TCAGAGTTCCCTACCGAAGCAG P0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATG...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Nck-1 selectively modulates eIF2aSer51 phosphorylation by a subset of eIF2a-kinases docx
... specific mRNAs. This is well illustrated by the increased translation of the acti- vating transcription factor 4 (ATF4), a transcription factor that initiates a transcriptional program increas- ing ... strongly impair the phosphorylation of eIF2aSer51, attenuation of translation and polysomal dissociation that nor- mally occur in response to pharmacological induction of ER stre...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Lipins from plants are phosphatidate phosphatases that restore lipid synthesis in apah1Dmutant strain of Saccharomyces cerevisiae ppt
... SG DVDGTG DVDGT A A G A DVDGT SG AAAA Fig. 1. PAH1 homologs from plants have similar domain organiza- tion to yeast PAH1 (ScPAH1) polypeptide. Arabidopsis PAH1 (At- PAH1), Arabidopsis PAH2 (AtPAH2) and B. napus ... 5¢-ATGTATCTTGA TAATTCTGCTGAAGCATATTTCATCAGG-3¢ and R4: 5¢-CCTGATGAAATATGCTTCAGCAGAATTATCAAG ATACAT-3¢); D70 7A (F5: 5¢- ACCAAGATAGTGATTT 0 1 2 3 4 5 6 7 8 Leaves Flowers B...
Ngày tải lên: 15/03/2014, 00:20