báo cáo khoa học: "Persistence of TEL-AML1 fusion gene as minimal residual disease has no additive prognostic value in CD 10 positive B-acute lymphoblastic leukemia: a FISH study" doc

... residual diseaseFigure 3 TEL-AML1 fusion as a minimal residual disease. Kap- lan-Meier curve for the persistence of TEL-AML1 fusion as a minimal residual disease (MRD) as a predictor of overall ... Satake N, Sakashita A, Kobayashi H, Maseki N, Sakurai M, Kaneko Yl: Minimal residual disease with TEL-AML1 fusion transcript in childhood acute ly...

Ngày tải lên: 10/08/2014, 22:20

... transporter. Clinical data on ADMA are growing. A high plasma level of ADMA is considered a novel cardiovascular risk factor. Nowadays, it is clear that ADMA contributes to vascular pathology in atherothrombotic ... kininase 2) inhibitors; ADMA, asymmetric dimethylarginine; ASA, acetylsalicylic acid; BH4, tetrahydrobiopterin; Bk, bradykinin; BPF, bradykinin potentiating factor; CAD, c...

Ngày tải lên: 07/03/2014, 21:20

... previously known as a seed albumin [5], it was named PA1b for pea albumin 1b. PA1b is the result of the post-translational cleavage of the albumin proprotein PA1, also releasing a second peptide (PA 1a) . ... time are enzyme inhibitors (including for example trypsin, a- amylase and carboxypeptidase) [18]. PA1b is of plant source, but all inhibitory assays conducted until now has...

Ngày tải lên: 08/03/2014, 02:21

... cocktail (Quick- safe A, Zinsser Analytic, Frankfurt/Main, Germany). The radioactivity was quantified in a Canberra-Packard Tricarb-2500 counter. The kinetic constants of transport were estimated ... proteins acting as sensors it has been shown that insertional mutations led to constitutive induction [11,22]. In case of the mutated bacterial iron transporter FecA it has been p...

Ngày tải lên: 08/03/2014, 08:20

... phosphorylation state is determined by the level of activity of a myriad of signaling cascades that leads to the activation of CREB kinases such as PKA, RSK, calmodulin kinase and MSK1/2. It was suggested that ... induced a rapid increase in the amount of the active GTP-bound form of RhoA culminating in a sixfold increase after 5 min. S1P effects on RhoA activation was...

Ngày tải lên: 08/03/2014, 08:20

... CTTGGCTGCTTGCGAGCTGTTATTCT TTTCAATCC; LmS12 2A (R), GGATTGAAAAGAATAA CAGCTCGCAAGCAGCCAAG; LmA105S (F), TTGACA GAACTGGTATCAAAGATGAGAGAAATG; LmA105S (R), CATTTCTCTCATCTTTGATACCAGTTCTGTCAA; LmT9 4A (F), CAAGCTGGAGTCGGCGCAATATTTGA CAGAGTTTTG; ... CTCGAGAACCATGGAAGA CGCCAAAAACATAAAG; KZKLUC1 (F), CTCGAGAA CAATGGAAGACGCCAAAAACATAAAG. The bold letters in the primers show Kozak sequence. The luci...

Ngày tải lên: 15/03/2014, 23:20

... factor characterizing activity of ATP synthase in a particular mitochondrial preparation Estimated on the basis of fitting of the model against our data n SYN 3H + ⁄ ATP ratio [65] v 0.9 Parameters ... phosphorylation rate than the increase of electric potential and corresponding increase in ATP– ADP steady-state exchange rate mediated by the ANT. As also seen in Fig. 3, the...

Ngày tải lên: 16/03/2014, 00:20

... study are listed in Table 1. Plasmid pCJ31B contains the L. lactis pyrG gene, and was made from a PCR-product made with prim- ers pyrG1 1a (5¢-GTAGAAGCTAAAATCTGG-3¢)and SLLH7 (5¢-TACAAAAGATTTTGGGC-3¢) ... 2.5-fold and that the average in vivo activity of CTP synthase is correspondingly increased. Increased in vivo activity of CTP synthase may be due to the reduced CTP concentra...

Ngày tải lên: 16/03/2014, 16:20

... aa 60 aa 38 aa 16 aa 5828 bp 3262 bp 23 aa 60 aa 38 aa 16 aa 7629 bp 6815 bp 7470 bp 23 aa 60 aa 38 aa 16 aa 1959 bp 3453 bp 1222 bp 23 aa 60 aa 38 aa 16 aa 554 bp 2277 bp 4313 bp 23 aa 60 aa ... hind- brain and spinal cord from early stages of embryogenesis. crabp 1a mRNA was detected in the forebrain and midbrain at later developmental stages. In adult zebrafish, crabp 1a mRNA was lo...

Ngày tải lên: 16/03/2014, 22:20

... 5¢-GTCACCACA GGCTAGCTACAACGACCAGGCACT-3¢ Dz483 (mutant) 5¢-ACACCACTG GGCTAGCTACAACGATCACGGACC-3¢ 483 nt Dz720 (active) 5¢-GAGCATCCA GGCTAGCTACAACGAGGGTGCTGT-3¢ Dz720 (mutant) 5¢-TAGAGCCAC GGCTAGCTACAACGATTGGCGTGG-3¢ ... serine protease family, which includes plasmin and urokin- ase-type plasminogen activator (uPA), has been identi- fied as being involved in the metastatic process. In...

Ngày tải lên: 16/03/2014, 22:20