báo cáo khoa học: "Malignant fibrous histiocytoma of the urinary bladder as a post-radiation secondary cancer: a case report" pdf
báo cáo khoa học: "Malignant fibrous histiocytoma of the urinary bladder as a post-radiation secondary cancer: a case report" pdf
... 190:311-332.doi:10.1186/1752-1947-5-549Cite this article as: Nimmanon and Ruengpoka: Malignant fibrous histiocytoma of the urinary bladder as a post-radiation secondary cancer: a case report. Journal of Medical Case Reports 2011 ... the urinary bladder as a post-radiation secondary cancer: a case reportThirayost Nimmanon1*and Poonkiat Ruengpoka2AbstractIntroduction: Malignant fibrous histiocytomas have been periodically ... report a case of malignant fibrous histiocytoma originating from the urinary blad-der, presenting as a post-radiation bladder cancer. Case presentation A 54-year old Thai woman presented to our facility...
- 6
- 493
- 0
báo cáo khoa học:" Malignant fibrous histiocytoma of the face: report of a case" ppsx
... plastic reconstruction of the face. AB and ABü did the histological and immunhistolog-ical analysis and contributed to the final conclusions of the case report. UJ suggested the idea for the case ... skin of the extremities and of the head andneck. They are among the most common soft tissuelesions of the skin [1]. Their biological nature, in particu-lar whether they are neoplastic or reactive, ... histological pattern, a number of variants arerecognized, some of which can be confused with sarcoma. Of the cellular and atypical types, about 20% are localisedin the head and neck region, they usually...
- 5
- 259
- 0
báo cáo khoa học: "Malignant fibrous histiocytoma originating from the mesorectum: a case report" ppt
... a case reportYoshifumi Nakayama*, Noritaka Minagawa, Takayuki Torigoe, Koji YamaguchiAbstractBackground: Malignant fibrous histiocytoma (MFH) is a common sarcoma affecting soft tissues of ... K, Komatsuda T, Hamashima Y, Sato M,Masamune O: Sonographic findings of malignant fibrous histiocytoma of mesentery-report of two cases. Eur J Ultrasound 1998, 8:207-212.10. Higa T, Yamada M, ... coating (arrows).B A Figure 3 A) A laparotomy revealed a child-head-sized tumor that encased the other organs (arrows). B) An operative specimen revealed a polycystic tumor with a part of the...
- 5
- 330
- 0
báo cáo khoa học: "Solitary fibrous tumor of the liver: a case report" docx
... (C)Contrast enhancement in arterial and portal phases was found in the mass. (D) Grossly, a large, gray-white, lobulated, well-circumscribed, partially encapsulated mass was removed afterhepatoectomy.Figure ... that of otherlesions of the liver. The radiological findings may su ggest the diagnosis of SFT, but benign or malignant hepatic tumors such as hepatocellular carcinoma, sarcoma, leiomyoma, andinflammatory ... Presentation A 59-year-old man was admitted to our hospital because of progressive fatigue for 3 months and an abdominalmass for 3 days. The patient had no history of viralhepatitis. Laboratory tests,...
- 3
- 399
- 0
Báo cáo khoa học: "Solitary fibrous tumor of the male breast: a case report and review of the literature" pptx
... Bombonati A, Parra JS, Schwartz GF, Palazzo JP: Solitary fibrous tumor of the breast. Breast J 2003, 9:251.2. Hofmann T, Braun H, Kole W, Beham A: Solitary fibrous tumor of the submandibular gland. ... entities have substantially the same clinical and bio-logical behavior. Furthermore, differential diagnosis of a breast mass in a male routinely must distinguish fromgynecomastia, which remains the ... solitary fibrous tumor and myofibroblastoma of the breast: a clinico-pathological analysis of 13 cases in favour of a unifying histogenetic concept. Virchows Arch 2002,440:249-260.10. Magro...
- 4
- 359
- 0
Báo cáo khoa học: "Solitary fibrous tumor of the pleura presenting with syncope episodes when coughing" docx
... of a common faint, and consequently a diag-nosis of situational syncope when coughing was made. The negative results of the cardiovascular tests associatedto the presence of a large thoracic ... sound in the affectedhemithorax. The neurological examination was negative.Blood pressure was 170/80 mmHg, heart rate was 90beats/minute and rhythmic. Laboratory findings, arterialgas analysis, ... reported. Case presentation: We herein describe a case of 72 year-old man with head, facial, and thoracictraumas caused by neurally-mediated situational syncope when coughing. The diagnostic...
- 5
- 299
- 0
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf
... the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG(31 bp) in the 3¢-UTR of the cDNA sequence (Fig. 1). A TATA box was identified 28 bp upstream from the cDNA ... revealed that the trout IL-11 gene has the same five exon ⁄ fourintron gene organization, as well as the same intron phase, as mammalianIL-11 genes. The 204 amino acid trout IL-11 translation has ... translation had 204 amino acids, a cal-culated molecular mass of 23.3 kDa and a theoreticalisoelectric point (pI) of 9.77. A signal peptide of 26amino acids was predicted [32]. Thus the mature...
- 12
- 511
- 0
báo cáo khoa học: "An unusual presentation of precursor T cell lymphoblastic leukemia/lymphoma with cholestatic jaundice: case report" pot
... revealing the same tumor cell morphology as that of CT guided mediastinal mass biopsy. It also revealed intrahepatic cholestasis in the form of intracanalicular bile plugs. F. H&E staining of ... A chest x-ray (Figure 1A) obtained at the same time revealed a huge mediasti-nal mass with evidence of mediastinal widening. CT scan of the chest (Figure 1B) showed 3 anterior mediastinalmasses ... suggestive of intrahe-patic cholestasis. The significantly elevated serum CA 19-9 level was later attributed to the cholestatic jaundicerather than primary hepatobiliary and pancreatic malig-nancies...
- 6
- 338
- 0
báo cáo khoa học: "Solitary pulmonary nodule of benign metastasizing leiomyoma associated with primary lung cancer: a case report" ppt
... CAS E REP O R T Open AccessSolitary pulmonary nodule of benignmetastasizing leiomyoma associated with primarylung cancer: a case reportMasahiro Naito1, Tetsu Kobayashi1*, Masamichi ... prognosis of the disease is also unclear.In the present reported case, although the pathologicalstage of lung carcinoma was stage IA, we consideredtha t CT follow-up was necessary at intervals of ... 10:97-99.doi:10.1186/1752-1947-5-500Cite this article as: Naito et al.: Solitary pulmonary nodule of benignmetastasizing leiomyoma associated with primary lung cancer: a case report. Journal of Medical Case Reports 2011...
- 4
- 197
- 0
Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ