báo cáo khoa học: "Malignant fibrous histiocytoma of the urinary bladder as a post-radiation secondary cancer: a case report" pdf

... 190:311-332. doi:10.1186/1752-1947-5-549 Cite this article as: Nimmanon and Ruengpoka: Malignant fibrous histiocytoma of the urinary bladder as a post-radiation secondary cancer: a case report. Journal of Medical Case Reports 2011 ... the urinary bladder as a post-radiation secondary cancer: a case report Thirayost Nimmanon 1* and Poonkiat Ru...

Ngày tải lên: 10/08/2014, 22:20

... plastic reconstruction of the face. AB and ABü did the histological and immunhistolog- ical analysis and contributed to the final conclusions of the case report. UJ suggested the idea for the case ... skin of the extremities and of the head and neck. They are among the most common soft tissue lesions of the skin [1]. Their biological nature, in particu- lar w...

Ngày tải lên: 12/08/2014, 00:20

... a case report Yoshifumi Nakayama * , Noritaka Minagawa, Takayuki Torigoe, Koji Yamaguchi Abstract Background: Malignant fibrous histiocytoma (MFH) is a common sarcoma affecting soft tissues of ... K, Komatsuda T, Hamashima Y, Sato M, Masamune O: Sonographic findings of malignant fibrous histiocytoma of mesentery-report of two cases. Eur J Ultrasound 1998, 8:207-212. 10....

Ngày tải lên: 09/08/2014, 01:24

... (C) Contrast enhancement in arterial and portal phases was found in the mass. (D) Grossly, a large, gray-white, lobulated, well- circumscribed, partially encapsulated mass was removed after hepatoectomy. Figure ... that of other lesions of the liver. The radiological findings may su ggest the diagnosis of SFT, but benign or malignant hepatic tumors such as hepatocellular car...

Ngày tải lên: 09/08/2014, 01:24

... Bombonati A, Parra JS, Schwartz GF, Palazzo JP: Solitary fibrous tumor of the breast. Breast J 2003, 9:251. 2. Hofmann T, Braun H, Kole W, Beham A: Solitary fibrous tumor of the submandibular gland. ... entities have substantially the same clinical and bio- logical behavior. Furthermore, differential diagnosis of a breast mass in a male routinely must distinguish from gy...

Ngày tải lên: 09/08/2014, 07:21

... of a common faint, and consequently a diag- nosis of situational syncope when coughing was made. The negative results of the cardiovascular tests associated to the presence of a large thoracic ... sound in the affected hemithorax. The neurological examination was negative. Blood pressure was 170/80 mmHg, heart rate was 90 beats/minute and rhythmic. Laboratory findings,...

Ngày tải lên: 09/08/2014, 07:21

... the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR of the cDNA sequence (Fig. 1). A TATA box was identified 28 bp upstream from the cDNA ... revealed that the trout IL-11 gene has the same five exon ⁄ four intron gene organization, as well as the same intron phase, as mammalian IL-11 genes. The 204 am...

Ngày tải lên: 07/03/2014, 16:20

...

Ngày tải lên: 07/08/2014, 15:20

... revealing the same tumor cell morphology as that of CT guided mediastinal mass biopsy. It also revealed intrahepatic cholestasis in the form of intracanalicular bile plugs. F. H&E staining of ... A chest x-ray (Figure 1A) obtained at the same time revealed a huge mediasti- nal mass with evidence of mediastinal widening. CT scan of the chest (Figure 1B) showed 3 a...

Ngày tải lên: 10/08/2014, 22:20

... CAS E REP O R T Open Access Solitary pulmonary nodule of benign metastasizing leiomyoma associated with primary lung cancer: a case report Masahiro Naito 1 , Tetsu Kobayashi 1* , Masamichi ... prognosis of the disease is also unclear. In the present reported case, although the pathological stage of lung carcinoma was stage IA, we considered tha t CT follow-up was necessary...

Ngày tải lên: 10/08/2014, 23:20