Candida infections detection and epidemiology - part 7 doc

... 09080 70 605040302010CBS562CBS1912CBS1905ATCC9002810A 173 07C06919A56806A30904A08008E05819A5 67 23D04519A519TY7 27 TY728ATCC90029TY73215A20615A56117A38116C08815A02016A43812E03319A16411C03410C0 07 11A13416A232TY729CBS8501CBS7988CBS850018A221CBS79 87 20C14923A1 37 02A03805C12105C118TY719TY718TY714TY715ATCC90030TY716TY7 17 TY731CBS138TY723TY722TY726CBS 573 CBS 60 7 CBS94CBS231011D028TY739TY7 37 TY736ATCC90018TY73507A212CBS219510A12014A16110A311CBS604CBS441314A0 97 CBS2024CBS566C. ... 09080 70 605040302010CBS562CBS1912CBS1905ATCC9002810A 173 07C06919A56806A30904A08008E05819A5 67 23D04519A519TY7 27 TY728ATCC90029TY73215A20615A56117A38116C08815A02016A43812E03319A16411C03410C0 07 11A13416A232TY729CBS8501CBS7988CBS850018A221CBS79 87 20C14923A1 37 02A03805C12105C118TY719TY718TY714TY715ATCC90030TY716TY7 17 TY731CBS138TY723TY722TY726CBS 573 CBS ... ATCC 90030 TY714 (VUMC) TY715 (VUMC) TY716 (VUMC) TY7 17 (VUMC) TY718 (VUMC) TY719 (VUMC) TY731 (VUMC) unknown Iowa, USA Amsterdam, the Netherlands Amsterdam, the Netherlands Amsterdam,...

Candida infections detection and epidemiology - part 2 docx

... description 5 5 -7 6 - ATGTCTAAGTATAAGCAATTTA p2.1 forward NASBA primer 27 1-2 53 - AATTCTAATACGACTCACTATAGGGAG- p1.1 reverse NASBA primer with AGACATGCGATTCGAAAAGTTAb T7 promotor site 15 7- 1 74 HRPO ... tropicalis, Candida albicans, Candida glabrata, and Candida lusitaniae. Using rRNA dilutions obtained from pure cultures of C. albicans, the combination of NASBA and the enzymatic bead-based detection ... probe UNI2, and were negative with the other Candida probes. Thirty-two clinical isolates of Candida spp. were tested by NASBA amplification and enzyme bead-based identification. Twenty-five strains...

Candida infections detection and epidemiology - part 10 docx

... cultures in patients with candidaemia. Eur. J. Clin. Microbiol. Infect. Dis. 19: 80 3-8 05 5. Borst, A., M.A. Leverstein-Van Hall, J. Verhoef, and A.C. Fluit. 2001. Detection of Candida spp. in blood ... acid sequence-based amplification (NASBA) detection of medically important Candida species. J. Microbiol. Methods 38: 8 1-9 0 4. Borst, A., M. Leverstein-Van Hall, J. Verhoef, and A. Fluit. ... NASBA-based assay for detection of Candida spp. in blood and blood cultures. Clin. Lab. (In press) 7. Borst, A., A.T.A. Box, and A.C. Fluit. 2002. False-positive results and contaminations in nucleic...

Candida infections detection and epidemiology - part 1 pps

... RNAprimer 2RNase Hprimer 1anti-sense RNAT7 RNA polymeraseReverse TranscriptaseReverse Transcriptase Candida infections detection and epidemiology Candida infecties detectie en ... Pinzcowski, and S. Vartivarian. 19 97. The epidemiology of hematogenous candidiasis caused by different Candida species. Clin. Infect. Dis. 24: 112 2-1 128 2. Azumi, M. and N. Goto-Yamamoto. 2001. ... increased, and so has the number of life-threatening Candida infections 1. At present, Candida is the 4th most common bloodstream pathogen in North America and ranks 8th in Europe13,19. High-risk...

Candida infections detection and epidemiology - part 4 pdf

... - 3 1c - 2 176 - 1d - - - 3a - - - 3b - - - 5a - - - 5b - 1913 + 2 176 - 10 1a - 2 176 2 176 1b - 2 176 1913 1c - - 1913 1d - - - 3a (Staphylococcus epidermidis) 1913 - 3b (Staphylococcus ... 1d Candida albicans - n.d. 3a - - - 3b (Enterococcus faecalis) - - 5a (Enterococcus faecalis) - - 5b (Staphylococcus aureus) 1913 - 7 1a Candida albicans - 19133 1b - - - 3 1c - ... 19 1b 4 2 4 6 2 1 1 - - - - 1 4 - - 3 - no no yes yes yes yes 2 1 5 6 6 - 4 - 6 no no 3 1 2 3 4 2 2 2 2 - - 1 - 2 1 1 1 no no no no BCB:...

Candida infections detection and epidemiology - part 5 pot

... glabrata - - - - - - - - - - lusitaniae - - - - - - - - - - krusei - - - - - - - - - - tropicalis - - - - + /- - - - - + albicans - + - - - + - - - - yeast/fungi - + + + + + + - + + AN: ... pos. neg. neg. neg. neg. pos. neg. neg. albicans - - - + - - - - + - - yeast/fungi - - - + - - + /- + /- + - + /- AN: assay negative (probe + detection diluent) neg.: negative control (no template ... albicans - - - - + /- - - - yeast/fungi - - - - + - - - AN: assay negative (probe + detection diluent) neg.: negative control (no template added to NASBA) pos.: positive control (0 .70 fg C....

Candida infections detection and epidemiology - part 8 potx

... Microbiol. 35: 133 2-1 336 7. De Bernardis, F., P.A. Sullivan, and A. Cassone. 2001. Aspartyl proteinases of Candida albicans and their role in pathogenicity. Med. Mycol. 39: 30 3-3 13 8. Diaz-Guerra, T.M., ... 10095908580 75 70 65605516A1 07 16A23215A02015A2 37 10A34311A38416E01416A55116E02617A38112E 070 12E03610A13912A10311A18218E01423D04616E03318A22016C0 67 15A2 57 13A14515A09310A13811C03406A2 67 19A29816E05015A 375 15E10616A30806A06315A62915A6 47 19A35515A20615A56117A18411A30116C08819A26020C10820C1 47 01A12020C11007C 073 08A24007C06007A52410C02120A15619A56810A50610A 570 10A53509A26323E05523A08019A56604A08007C04507A30123E00307C06623A00523A 078 07A62106A12506A30904A36006A15424A02804A12208E05808A 573 09A4 37 23E09508A42410C0 07 11A13410C02610A14410A55510A60020C 072 11A21906A03815D01310A61416C08116A38015A16017A46224E0 07 Cluster ... 10095908580 75 70 65605516A1 07 16A23215A02015A2 37 10A34311A38416E01416A55116E02617A38112E 070 12E03610A13912A10311A18218E01423D04616E03318A22016C0 67 15A2 57 13A14515A09310A13811C03406A2 67 19A29816E05015A 375 15E10616A30806A06315A62915A6 47 19A35515A20615A56117A18411A30116C08819A26020C10820C1 47 01A12020C11007C 073 08A24007C06007A52410C02120A15619A56810A50610A 570 10A53509A26323E05523A08019A56604A08007C04507A30123E00307C06623A00523A 078 07A62106A12506A30904A36006A15424A02804A12208E05808A 573 09A4 37 23E09508A42410C0 07 11A13410C02610A14410A55510A60020C 072 11A21906A03815D01310A61416C08116A38015A16017A46224E0 07 Cluster...

Candida infections detection and epidemiology - part 9 pps

... 93: 12 47 3-1 2 477 13. Gumbo, T., C.M. Isada, G. Hall, M.T. Karafa, and S.M. Gordon. 1999. Candida glabrata Fungemia. Clinical features of 139 patients. Medicine (Baltimore) 78 : 22 0-2 27 14. Hull, ... suspected candidaemia and patients under treatment for candidaemia might be valuable. Chapters 2, 3 and 4 describe the development of a NASBA assay for the detection of Candida species in blood and ... Sequence-Based Amplification (NASBA™)6 and Amplified Fragment Length Polymorphism analysis (AFLP™)35. DETECTION OF CANDIDA INFECTIONS The current routine detection method for Candida infections, ...

Tài liệu Ielts preparationg and practice rading and writing part 7 doc

...

Lasers Applications in Science and Industry Part 7 docx

... Shore, and M. D. Perry, “Nanosecond-to-femtosecond laser-induced breakdown in dielectrics,” Phys. Rev. B 53, 174 9-1 76 1, 1996. [5] H. Wang and A. M. Weiner, “Efficiency of short-pulse type-I second-harmonic ... glasses for high-energy/high-peak-power lasers,” J. Non-Crystal. Solids 26 3-2 64, 31 8-3 41, 2000. [14] Ya. B. Zel'dovich and Yu. P. Raizer, Physics of Shock Waves and High-Temperature Hydrodynamic ... Appl. Phys. 72 , 270 5-2 71 2, 1992. [25] M. Huang, F. Zhao, Y. Cheng, N. Xu, and Z. Xu, “Origin of Laser-induced Near-Subwavelength Ripples: Interference between Surface Plasmons and Incident...

Xem thêm

Từ khóa: tài liệu longman preparation series for the new toeic test part 7 docx thiết kế bài giảng lịch sử 8 tập 1 part 7 docx epidemiology management and risk factors for death of invasive candida infections in critical care grammar and vocabulary games for children part 7 pdf 15 tr thermal analysis fundamentals and applications to polymer science part 7 pot anh văn 7 unit nine at home and away phần 1 docx the monopoly doctrine and keynesianism p 7 signal detection and estimation detection and clinical importance printing saving and closing part files toefl cbt book part 7 writing template part 7 reading upper intermediate part 7 teaching academic esl writing part 7 kaplan toefl paper and pencil part 2 Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 chuyên đề điện xoay chiều theo dạng Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Chuong 2 nhận dạng rui ro Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP