Candida infections detection and epidemiology - part 7 doc
... 0 90 80 70 60 50 40 30 20 10 CBS562 CBS1912 CBS1905 A TCC9002 8 10A 173 07C069 19A568 06A309 04A080 08E058 19A5 67 23D045 19A519 TY7 27 TY728 A TCC9002 9 TY732 15A206 15A561 17A381 16C088 15A020 16A438 12E033 19A164 11C034 10C0 07 11A134 16A232 TY729 CBS8501 CBS7988 CBS8500 18A221 CBS79 87 20C149 23A1 37 02A038 05C121 05C118 TY719 TY718 TY714 TY715 A TCC9003 0 TY716 TY7 17 TY731 CBS1...
Ngày tải lên: 10/08/2014, 16:22
... description 5 5 -7 6 - ATGTCTAAGTATAAGCAATTTA p2.1 forward NASBA primer 27 1-2 53 - AATTCTAATACGACTCACTATAGGGAG- p1.1 reverse NASBA primer with AGACATGCGATTCGAAAAGTTA b T7 promotor site 15 7- 1 74 HRPO ... tropicalis, Candida albicans, Candida glabrata, and Candida lusitaniae. Using rRNA dilutions obtained from pure cultures of C. albicans, the combination of NAS...
Ngày tải lên: 10/08/2014, 16:22
... cultures in patients with candidaemia. Eur. J. Clin. Microbiol. Infect. Dis. 19: 80 3-8 05 5. Borst, A., M.A. Leverstein-Van Hall, J. Verhoef, and A.C. Fluit. 2001. Detection of Candida spp. in blood ... acid sequence-based amplification (NASBA) detection of medically important Candida species. J. Microbiol. Methods 38: 8 1-9 0 4. Borst, A., M. Leverstein-Van Hall, J. Ve...
Ngày tải lên: 10/08/2014, 16:22
Candida infections detection and epidemiology - part 1 pps
... RNA primer 2 RNase H primer 1 anti-sense RNA T7 RNA polymerase Reverse Transcriptase Reverse Transcriptase Candida infections detection and epidemiology Candida infecties detectie en ... Pinzcowski, and S. Vartivarian. 19 97. The epidemiology of hematogenous candidiasis caused by different Candida species. Clin. Infect. Dis. 24: 112 2-1 128 2. Azumi, M. and N...
Ngày tải lên: 10/08/2014, 16:22
Candida infections detection and epidemiology - part 4 pdf
... - 3 1c - 2 176 - 1d - - - 3a - - - 3b - - - 5a - - - 5b - 1913 + 2 176 - 10 1a - 2 176 2 176 1b - 2 176 1913 1c - - 1913 1d - - - 3a (Staphylococcus epidermidis) 1913 - 3b (Staphylococcus ... 1d Candida albicans - n.d. 3a - - - 3b (Enterococcus faecalis) - -...
Ngày tải lên: 10/08/2014, 16:22
Candida infections detection and epidemiology - part 5 pot
... glabrata - - - - - - - - - - lusitaniae - - - - - - - - - - krusei - - - - - - - - - - tropicalis - - - - + /- - - - - + albicans - + - - - + - - - - yeast/fungi - + + + + + + - + + AN: ... pos. neg. neg. neg. neg. pos. neg. neg. albica...
Ngày tải lên: 10/08/2014, 16:22
Candida infections detection and epidemiology - part 8 potx
... Microbiol. 35: 133 2-1 336 7. De Bernardis, F., P.A. Sullivan, and A. Cassone. 2001. Aspartyl proteinases of Candida albicans and their role in pathogenicity. Med. Mycol. 39: 30 3-3 13 8. Diaz-Guerra, T.M., ... 100 95 90 85 80 75 70 65 60 55 16A1 07 16A232 15A020 15A2 37 10A343 11A384 16E014 16A551 16E026 17A381 12E 070 12E036 10A139 12A103 11A182 18E014 23D046 16E033 18A2...
Ngày tải lên: 10/08/2014, 16:22
Candida infections detection and epidemiology - part 9 pps
... 93: 12 47 3-1 2 477 13. Gumbo, T., C.M. Isada, G. Hall, M.T. Karafa, and S.M. Gordon. 1999. Candida glabrata Fungemia. Clinical features of 139 patients. Medicine (Baltimore) 78 : 22 0-2 27 14. Hull, ... suspected candidaemia and patients under treatment for candidaemia might be valuable. Chapters 2, 3 and 4 describe the development of a NASBA assay for the detection of...
Ngày tải lên: 10/08/2014, 16:22
Tài liệu Ielts preparationg and practice rading and writing part 7 doc
Ngày tải lên: 14/12/2013, 13:15
Lasers Applications in Science and Industry Part 7 docx
... Shore, and M. D. Perry, “Nanosecond-to-femtosecond laser-induced breakdown in dielectrics,” Phys. Rev. B 53, 174 9-1 76 1, 1996. [5] H. Wang and A. M. Weiner, “Efficiency of short-pulse type-I second-harmonic ... glasses for high- energy/high-peak-power lasers,” J. Non-Crystal. Solids 26 3-2 64, 31 8-3 41, 2000. [14] Ya. B. Zel'dovich and Yu. P. Raizer, Physics of Shoc...
Ngày tải lên: 18/06/2014, 22:20