báo cáo khoa học: "Opinion leaders and changes over time: a survey" potx
... RESEARC H Open Access Opinion leaders and changes over time: a survey Gaby Doumit 1* , Frances C Wright 2 , Ian D Graham 2,3 , Andrew Smith 2 and Jeremy Grimshaw 4 Abstract Background: Opinion leaders ... sts and 17 gener al surgeons were nominated as opinion leaders for co lorectal cancer. Pathologist opi- nion leaders for colorectal cancer had a mean age of 50.7 year...
Ngày tải lên: 10/08/2014, 11:20
... 275–283. 10 Kuwada M, Teramoto T, Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin- TK containing D-serine at position 46, but ... semipreparative column was from Agilent Tech- nologies (Santa Clara, CA, USA), and trifluoroacetic acid and acetonitrile used for HPLC were from Merck (Darms- tadt, Germany). Trypsin and t...
Ngày tải lên: 18/02/2014, 17:20
... CTGATCTAGAGGTACCGGATCC 5RACF ATCCTCACGAACAAGCAG 5RACR GATCGCGATGCAGGCCTT FLF1 GGACGACTACAGCGTCTTCAGTAGA FLR1 TCCAAACAGTCAGTTTCTTAACCGT Table 1. Purification of cellulase from abalone Haliotis discus hannai. ... The translational start codon ATG, termination codon TAA, and a putative polyadenylation signal AATAAA are boxed. A putative signal peptide is indicated by a dotted underline. T...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt
... Chicester. 32. Mu ¨ hlradt, P.F. & Frisch, M. (1994) Purification and partial bio- chemical characterization of a Mycoplasma fermentans-derived substance that activates macrophages to release nitric oxide, tumor ... i.e. agonistically as well as antagonistically, completely inactive. The lack of antagonistic activity may be explained by the fact that this lipid A does not intercalate...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf
... L, Hamid Q & Elias JA (2004) Acidic mammalian chitinase in asthmatic Th2 inflammation and IL-13 pathway activation. Science 304, 1678– 1682. 4 Kasprzewska A (2003) Plant chitinases ) regulation ... 491–503. 24 Aronson NN, Halloran BA, Alexyev MF, Amable L, Madura JD, Pasupulati L, Worth C & Van Roey P (2003) Family 18 chitinase–oligosaccharide substrate interaction: subsite prefere...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx
... HepG 2 cDNA library (C. Baisez and A. Harduin-Lepers, unpublished data), as the template and two specific primers For 6I 5¢-CGATGAATTC GTTAACGCTCATCACCATCACCATCACGGGAAA TTGGCCATGGGGT-3¢ containing a HpaIsiteandBack 6I ... the annealing of the two following synthetic oligonucleotides For EGT 5¢- GATCCGCCACCATGACCATCTTATGTTGGCTCG CTCTCCTGAGCACACTCACAGCTGTTAACGCTG ACATCA-3¢ and Back EGT...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: "CONTROL STRUCTURES AND THEORIES OF INTERACTION IN SPEECH" potx
... Computer Laboratory Corn Exchange Street, Cambridge CB2 3QG, England ABSTRACT lr: this paper, we approach the problem of organisation and control ip. automatic speech understanding systems firaT.ly, ... company to awarded, treating awarded as the main verb. In the case where awarded must be treated as the beginning cf a reduced relative, Warren found that the duration of the final...
Ngày tải lên: 08/03/2014, 18:20
Báo cáo khoa học: Identification and functional characterization of a novel barnacle cement protein pptx
... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKA Bacp19k VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSL Bicp19k AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV 130 ... 4339 Identification and functional characterization of a novel barnacle cement protein Youhei Urushida 1 , Masahiro Nakano 1 , Satoru Matsuda 1 , Naoko Inoue 2 , Satoru Kanai 2 , Naho K...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Ligand binding and antigenic properties of a human neonatal Fc receptor with mutation of two unpaired cysteine residues docx
... IgG and albumin [1–3], is a major histocompatibility complex (MHC) class I-related receptor consisting of a heavy chain (HC) with three ectodomains (a1 , a2 and a3 ), a transmembrane part and a short ... complex class I-related molecule that regulates the half-life of IgG and albumin. In addition, FcRn directs the transport of IgG across both mucosal epithe- lium and place...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf
... NIPPA, N-(5-nitro-2-pyridyl)-phenylacetamide; PhAc-pNA, phenylacetyl 4-nitroanilide; PhAc-pAB, 4-phenylacetamidobenzoic acid; PhAc-mAB, 3-phenylacetamidobenzoic acid; PhAc-oAB, 2-phenyl- acetamidobenzoic acid; PhAc-bNA, phenylacetyl ... The distances between the polar CO 2 – and O(NO) and positively charged guanidinium fragments of ArgA145 and ArgB263 are listed in Table 3. AM1 docking...
Ngày tải lên: 16/03/2014, 16:20