báo cáo khoa học: "Identifying quality improvement intervention publications - A comparison of electronic search strategies" pot

... This investigation of search strategies was part of a larger project aimed at the classification and critical appraisal of quality improvement publications. We aim to facili- tate literature syntheses, and expect ... study act.mp. OR pdca.ti, ab. OR plan-do-check-act.mp. OR plan do check act.mp. OR define-measure-analyze-improve- control.mp. OR dmaic.ti, ab. OR dmadv.ti, ab. OR...

Ngày tải lên: 10/08/2014, 11:20

... intra- cellular metabolites. An approach that combines flux balance analysis (FBA) with an ordinary differential equation (o.d.e.) model of the slow time scales is called dynamic flux balance analysis (dFBA), ... activates adenylate cyclase (CyaA) and leads to an increase in the intra- cellular cyclic AMP (cAMP) level [1]. Mathematical models of catabolite repression in E. coli The (isolate...

Ngày tải lên: 18/02/2014, 13:20

... Just as facilita- tor quality in interest circle calls may vary, so may the quality of coaching. Learning sessions occur periodically-in our case, twice a year. These face-to-face multi-day conferences ... to predict and explain the sustainabil ity of promising prac- tices that programs implemented. A research trial invol- ving 250 experts in healthcare policy and delivery, organi...

Ngày tải lên: 10/08/2014, 10:23

... Tokyo 10 4-0 045, Japan Email: Naoko Sanuki-Fujimoto - nao5-tky@umin.ac.jp; Satoshi Ishikura* - sishikur@ncc.go.jp; Kazushige Hayakawa - hayakazu@med.kitasato- u.ac.jp; Kaoru Kubota - kkubota@east.ncc.go.jp; ... GTV. CTV also included a regional (elecitve) nodal area which consisted of ipsilateral hilum and bilat- eral mediastinal (pretracheal, paratracheal, tracheo- bro...

Ngày tải lên: 09/08/2014, 09:22

... without chan- ging the overall reaction [50]. A rationally designed variant of L -Ala- D / L -Glu epimerase (a third member of the enolase superfamily, Fig. 8), containing a mutation (D297G) analogous ... to better anticipate the natural evolution of bacterial antibiotic resistance. Hydrolysis of aztreonam requires a change in the substrate specificity of TEM-1 b-lactamase. T...

Ngày tải lên: 19/02/2014, 12:20

... repeat amplification were: 1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGC ATGGC-3¢; and AAV65MGB/taq, 5¢-GTTAATGATT Table 1. Primers and probe sets used for qRT-PCR. Acronym ... CGCTTTCGGAGGTGCTTTCGCAG M1941p65.R: TCAGAGTTCCCTACCGAAGCAG P0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: AC...

Ngày tải lên: 07/03/2014, 03:20

Ngày tải lên: 08/03/2014, 01:20

... language strings annotated with their semantics, along with basic assumptions about natural lan- guage syntax. We show that the search space for grammar induction is a complete gram- mar lattice, which guarantees ... Systems Columbia University New York, NY 10027, USA rambow@cs.columbia.edu Abstract We propose a new language learning model that learns a syntactic-semantic grammar from...

Ngày tải lên: 08/03/2014, 02:21

... several signalling pathways, includ- ing the ERK1 ⁄ 2 pathway, the PKB pathway and the Janus kinase ⁄ signal transducer and activator of tran- scription (JAK-STAT) pathway, to promote prolifera- tion, ... (2007) AZD6244 (ARRY-142886), a potent inhibitor of mito- gen-activated protein kinase ⁄ extracellular signal-regu- lated kinase kinase 1 ⁄ 2 kinases: mechanism of action in vivo, ph...

Ngày tải lên: 16/03/2014, 00:20

... Cleveland, OH, USA Prion diseases are a group of fatal neurodegenerative disease in humans and animals. It is believed that all prion diseases are caused by the conversion of a nor- mal cellular ... top of the gradient. Modulation of GAG- or Cu 2+ -promoted aggregation of rPrP 10OR with anti-PrP mAbs We next investigated whether GAG- or Cu 2+ -pro- moted aggregation of rPrP 10...

Ngày tải lên: 16/03/2014, 04:20