báo cáo khoa học: " How to develop a program to increase influenza vaccine uptake among workers in health care settings?" potx

báo cáo khoa học: " How to develop a program to increase influenza vaccine uptake among workers in health care settings?" potx

báo cáo khoa học: " How to develop a program to increase influenza vaccine uptake among workers in health care settings?" potx

... AB: Factors affecting influenza vaccine uptake among health care workers. Occup Med (Lond) 2005, 55:474-479. 25. Hofmann F, Ferracin C, Marsh G, Marsh G, Dumas R: Influenza vaccination of healthcare ... Hulscher ME, Hak E: Effects of a multi-faceted program to increase influenza vaccine uptake among health care workers in nursing homes: A cluster rando...
Ngày tải lên : 10/08/2014, 10:23
  • 9
  • 353
  • 0
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

... mechanisms. Proc Natl Acad Sci USA 103, 13813–13818. 29 Yu L, Ikeda K, Kato A, Adachi I, Godin G, Compain P, Martin O & Asano N (2006) alpha-1-C-octyl-1-de- oxynojirimycin as a pharmacological chaperone ... lysosomal concentration of partially active GC vari- ants, as demonstrated by increased cellular GC activity, an increased concentration of lysosomal GC glyco- forms and increased c...
Ngày tải lên : 18/02/2014, 16:20
  • 7
  • 507
  • 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... L. lactis ald gene as follows. A PCR fragment was generated using primer CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ ... TP901-1 phage attachment site. PCR products upstream to pyk using primer pyk1 (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and do...
Ngày tải lên : 19/02/2014, 17:20
  • 12
  • 616
  • 0
Báo cáo khoa hoc:" The chicken as a model to study microchromosomes in birds: a review" potx

Báo cáo khoa hoc:" The chicken as a model to study microchromosomes in birds: a review" potx

... carte génomique / taux de recombinaison E-mail: vfillon@toulouse.inra.fr Despite all the comparative data available, it is still difficult to understand the evolutionary meaning ... and markers, leading to completed genetic maps. For this purpose, a collection of large insert BAC (bacterial artificial chromosome) and PAC (bacteriophage PI artificia...
Ngày tải lên : 09/08/2014, 18:21
  • 11
  • 318
  • 0
Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt

... the participating Table 1. Amino acid frequencies (%) in a- amylase linkers, in a set of globular proteins, in the Swiss-Prot databank and in intrinsically unstructured proteins. Amino acid Linkers a Globular proteins b Swiss-Prot c Intrinsically unstructured proteins b Ala ... function in activity, substrate binding and structural dynamics. Materials and methods Experimental d...
Ngày tải lên : 14/02/2014, 18:20
  • 8
  • 624
  • 0
Báo cáo khoa học: "HOW TO DETECT GRAMMATICAL ERRORS IN A TEXT WITHOUT PARSING IT" doc

Báo cáo khoa học: "HOW TO DETECT GRAMMATICAL ERRORS IN A TEXT WITHOUT PARSING IT" doc

... general Constituent Likelihood approach to grammatical analysis, and CLAWS in particular, can be used to analyse text including ill-formed syntax. More importantly, it can also be adapted to ... that this approach was impractical because of the time and effort required to collect the necessary data. In any case, an alternative technique which managed without a separate tabl...
Ngày tải lên : 24/03/2014, 05:21
  • 8
  • 470
  • 0
Báo cáo khoa học: "How to build a QA system in your back-garden: application for Romanian" pot

Báo cáo khoa học: "How to build a QA system in your back-garden: application for Romanian" pot

... How to build a QA system in your back-garden: application for Romanian Constantin Or5san Computational Linguistics Group University of Wolverhampton C.Orasan@w1v.ac.uk Doina Tatar, Gabriela ... newspaper articles and propose factual questions which can be answered using short texts from the articles. In addition to the human directed evaluation, we are planning to have also auto...
Ngày tải lên : 31/03/2014, 20:20
  • 4
  • 489
  • 1
báo cáo khoa học: "How to be a self-fertile hermaphrodite" ppt

báo cáo khoa học: "How to be a self-fertile hermaphrodite" ppt

... strong and the paternal investment is increased ; - or heterosis is weak and the maternal investment is increased. In self compatible species, the investment in the male and ... CHARLESWORTH (1981). C HARNOV et al. (1976) demonstrated that the presence of females caused an increase of a in the hermaphrodites ; we have seen that selfing...
Ngày tải lên : 09/08/2014, 22:23
  • 7
  • 316
  • 0
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

... (5¢-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3¢) was designed to insert a ClaI restric- tion site at nucleotide position )6, whereas the reverse primer (5¢ -ATCGCCATGGTCCCGGGCATATGGGATC CCTGGAAGTACAGGTTTTCCTTTTTAATGGGTGTC CC-3¢) ... mutual effects in fusion proteins containing an intrinsically disordered and a globular protein Ilaria Sambi 1 , Pietro Gatti-Lafranconi 1 *, Sonia Longhi...
Ngày tải lên : 18/02/2014, 04:20
  • 14
  • 672
  • 0