báo cáo khoa học: " Prevalence and consequences of patient safety incidents in general practice in the Netherlands: a retrospective medical record review study" potx

... countries with a strong primary healthcare system, such as the Netherlands, patients receive most of their medical care in general practice, but to date adequate data on the prevalence of patient safety incidents ... conducted a retrospective review of patient records in Dutch general practice. A random sample of 1,000 patients from 20 general pra...

Ngày tải lên: 10/08/2014, 10:23

... fact whether these widowed mothers may still be working and sharing the financial load of the family, or whether the underlying grief may make them an added dependant person in the family. The local ... AK ana- lyzed the data. All authors reviewed the final manuscript. Additional material Acknowledgements We are grateful to the Department of Psychiatry at Aga Khan Univ...

Ngày tải lên: 08/08/2014, 23:20

... ever and in the last three months, dura- tion of injecting, injecting while incarcerated, aspirating and re-inje cting blood (khoon bozee), and receiving assistance with injecting. Assistan ce ... 1). Generally, Afghanistan was the site for injecting initiation although about one-third initiated injecting as a refugee. Prevalence and Correlates of Infections Prevalence...

Ngày tải lên: 11/08/2014, 18:20

... each patient& apos;s ICU stay were recorded and the prevalence of severe sepsis was calculated. Then, the annual incidence of severe sepsis in The Netherlands was estimated, based on the prevalence, ... the prevalence, the estimated length of stay, and the capacity of the participating ICUs relative to the national intensive care capacity. Results The pa...

Ngày tải lên: 12/08/2014, 20:20

... 5¢-ACAAGGG TAGACCAAACACCAAGAACAGCAACAAAAGAG ACGGGCGAATCACTGACCATCAACgccGTCCTGA GAGAT-3¢) and N8518 (Reverse: 5¢-TTTCACGGTTAA TGCGGTGCCAGCTCCCCAACTGTAATAAATACC AGACAAATTATATGCTCCaacCCTATACGTGCCA CTG-3¢); followed by secondary PCR using ... disulphide minus variant of 12F-11 incorporating mutations Cys22Ala and Cys82Val was constructed by overlapping PCR using oligonucleotide primers N851...

Ngày tải lên: 17/03/2014, 10:20

... interests. Authors' contributions LWS responsible for the coordination of the project, data analysis, interpretation of the data and the drafting of manuscript. WCW has involved in the conception and design ... in the conception and design of the study and revising the manuscript. All authors have read and approved the final manuscript. Appendix Ap...

Ngày tải lên: 13/08/2014, 18:21

... (bp) C97 5 ′ -GCTATGACGGGTATCC- 3 ′ 400 C98 5 ′ -GATTTTACCCCTACACCA- 3 ′ H. felis F, 5 ′ -ATGAAACTAACGCCTAAAGAACTAG 1,150 R, 5 ′ -GGAGAGATAAAGTGAATATGCGT H. pylori F, 5 ′ -GGAATTCCAGATCTATGAAAAAGATTAGCAGAAAAG- ... study w as carried out to evaluate the prevalence and clinical characterizations of gastric Helicobacter spp. infection of dogs and cats in Korea. The prevalence...

Ngày tải lên: 07/08/2014, 15:20

... for citation purposes) Study setting Namibia is a southern African country that shares borders with Angola and Zambia to the north, Botswana and Zim- babwe to the east, and South Africa to the south. ... Psychiatry Open Access Primary research Prevalence and associated factors of physical fighting among school-going adolescents in Namibia Emmanuel Rudatsikira 1 , Seter...

Ngày tải lên: 08/08/2014, 23:20

... for the creation of many DHSs observed in mammalian cytokine genes [91]. NFAT, in turn, plays a major role in assisting the binding of AP-1 via cooperative binding, and creates an accessi- ble ... If a similar mechanism operates in mammalian cells, then KDM 2A may suppress this pathway and maintain histone acetylation at tran- scribed CG islands. It is becoming increa...

Ngày tải lên: 14/02/2014, 18:20

... UGUUGUUUUAGUGAUCAGAAGGU GY-box family miRNA Brd-box: 5´ AGCUUUA ||||||| dme-miR-4 3´ AGUUACCAACAGAUCGAAAUA dme-miR-79 3´ UACGAACCAUUAGAUCGAAAUA Brd-box family miRNAs K-box: 5´ cUGUGAUa |||||| dme-miR- 2a 3´ ... signaling pathway, (D) Hippo signaling pathway, (E) TGF-b signaling pathway, (F) Hh signaling pathway, and (G) Wnt signaling pathway. miRNAs and cell signaling A. Ichimura et a...

Ngày tải lên: 14/02/2014, 19:20