báo cáo khoa học: " A comparative evaluation of the process of developing and implementing an emergency department HIV testing program" pps
... MH074369 (T.L.). The authors would like to thank Kama Brockman at the California Office of AIDS and the participants of this study. Author details 1 San Francisco General Hospital HIV/ AIDS Division, ... conceived the study and obtained research funding. KC, KK, SW, and TL collected the data. KC, KK, and SW analyzed the data. KC drafted the manuscript and all auth...
Ngày tải lên: 10/08/2014, 10:23
... for an acceptable trans- lation. Because the prepositional phrase is a modifier of the main process (indicated by the role feature and the fact that the main process and the modifier are siblings ... non-hierarchical conceptual information and speech act information. Penman has a rich variety of inquiries dealing with such information and so makes availa...
Ngày tải lên: 09/03/2014, 01:20
... practical purposes, we can not claim that our algorithm is capable of finding all the fine grained distinctions that are listed in manually created dictionaries such as the Longman Dictionary ... this approach is that it allows only as many senses as clusters, thereby limiting the granularity of the meaning space. This problem is avoided by Neill (2002) who uses local instea...
Ngày tải lên: 20/02/2014, 16:20
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... CCCCATGTCGCCTTTAGT OMCB-KO-R TCGCTAGAACACATTGAC OMCA-F ATGATGAAACGGTTCAAT OMCA-R TTAGTTACCGTGTGCTTC OMCB-F CTGCTGCTCGCAGCAAGT OMCB-R GTGTGATCTGCAACTGTT OMCA-PBAD-F CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC OMCA-PBAD-R ... CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC OMCA-PBAD-R TTAGTTACCGTGTGCTTC OMCB-PBAD-F CACCGAGGAATAATAAATGATG AACGCACAAAAATCA OMCB-PBAD-R TTACATTTTCACTTTAGT Shewanella oneidensis MR...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Part-of-Speech Induction from Text" pdf
... be processed with our algo- rithms (SVD and clustering), we decided to restrict the number of rows to a vocabulary appropriate for evaluation purposes. Since we are not aware of any standard ... (1992). Class- based n-gram models of natural language. Computa- tional Linguistics 18(4), 467-479. Clark, Alexander (2003). Combining distributional and morphological information f...
Ngày tải lên: 08/03/2014, 04:22
Báo cáo khoa học: "A Computational Approach to the Automation of Creative Naming" ppt
... appropriate name. The three “palatable” neolo- gisms generated are eatalian (from the combination of eat and Italian), pastarant (pasta + restaurant) and peatza (pizza + eat). These three suggestions are amusing ... com- munications are available. Kohli et al. (2005) ana- lyzed consumer evaluations of meaningful and non- meaningful brand names and the results suggested that...
Ngày tải lên: 23/03/2014, 14:20
Báo cáo khoa học: " A biosensor assay for the detection of Mycobacterium avium subsp. paratuberculosis in fecal samples" potx
... Initially, a synthetic DNA target was used to optimize the assay to assess the signal-to-noise ratios with a relatively large dynamic range and the highest signal obtainable. The standard lateral-flow ... after challenge gave positive signals in the biosensor assay, which concurred with the MAP culture 36 Vijayarani Kumanan et al. handle systems for the detection and...
Ngày tải lên: 07/08/2014, 23:22
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx
... review and wrote the manuscript. RC and PH supervised the study and proof-read the manuscript. All authors read and approved the final manuscript. Competing interests The authors declare that they ... than 5 cm (pT1 and pT2 stage) and all the patients had wide local excisions performed. The slides and b locks were retrieved from the archives of the Anatomical...
Ngày tải lên: 09/08/2014, 01:24
Báo cáo khoa học: "A multidisciplinary approach for the treatment of GIST liver metastasis" docx
... reducing the tumor size and facilitating surgical resection. Conclusion: A well-planned multidisciplinary approach should be part of the standard management of advanced or metastatic GIST. Background Gastrointestinal ... cells of Cajal [1]. They affect mostly males between the ages of 50 and 70, and are usually found inci- dentally at early stages [1-4]. Large or advance...
Ngày tải lên: 09/08/2014, 07:21