báo cáo khoa học: " Improvement of primary care for patients with chronic heart failure: A study protocol for a cluster randomised trial comparing two strategies" pps

... 6:28 http://www.implementationscience.com/content/6/1/28 Page 5 of 7 STUDY PROT O C O L Open Access Improvement of primary care for patients with chronic heart failure: A study protocol for a cluster randomised trial comparing two strategies Jan van ... Majeed A, Williams J, de Lusignan S, Chan T: Management of heart failure in primary care...

Ngày tải lên: 10/08/2014, 10:23

... Hospital, Tardeo, Mumbai, India Email: Rajeev Krishnadas* - Rajeev.krishnadas@gmail.com; Brian P Moore - pbrianm@aol.com; Ajita Nayak - ajitanayak@rediffmail.com; Ramesh R Patel - drrrpatel@hotmail.com * ... Ajita Nayak 2 and Ramesh R Patel 3 Address: 1 Tranwell Unit, Queen Elizabeth Hospital, Gateshead, Tyne and Wear, UK, 2 BYL Nair Hospital, AL Nair Road, Mumbai, India and 3 Bhatia H...

Ngày tải lên: 08/08/2014, 23:20

... just a little better than average. As expected, the predicted risks of hospitalization and death were also lowest among patients with asthma. Because patients with chronic heart or lung disease ... physicians' and patients& apos; assessment of patients& apos; health, with patients& apos; affective state, somatization, and language of interview further influencing...

Ngày tải lên: 20/06/2014, 15:20

... for mutagenesis were as follows: LmS12 2A (F), CTTGGCTGCTTGCGAGCTGTTATTCT TTTCAATCC; LmS12 2A (R), GGATTGAAAAGAATAA CAGCTCGCAAGCAGCCAAG; LmA105S (F), TTGACA GAACTGGTATCAAAGATGAGAGAAATG; LmA105S (R), ... Easy vector to verify the integration of the Kozak sequences. The PCR primers used were as follows: KZK- LUC2 (F), CTCGAGAAAAATGGAAGACGCCAAAAAC ATAAAG; KZKLUC4 (F), CTCGAGAACCATGGAAGA CG...

Ngày tải lên: 15/03/2014, 23:20

... site adjacent to the ATG start codon and SacI downstream of the TAA stop codon for easy cloning in the forward and reverse primers, respectively (forward, 5¢-ctc gag ATG AAG AGA ACA CAT TTG GCA-3¢; ... starting quantity of the a- tubulin gene, which is assumed to be at a constant levels in all the samples. The Arabidopsis (forward, 5¢-AAG GCT TAC CAC GAG CAG CTA TCA-3¢; reverse, 5¢-A...

Ngày tải lên: 16/03/2014, 06:20

... traditional way. 3 The grammatical features The main goal of this paper is the incorporation of gramatical features to the WSME. Grammatical information may be helpful in many aplications of ... corpus was automatically labelled and man- ually checked. There were two kinds of labelling: POStag labelling and syntactic labelling. The POStag vocabulary was composed of 45 labels. The...

Ngày tải lên: 23/03/2014, 19:20

... report Improvement of chronic facial pain and facial dyskinesia with the help of botulinum toxin application Katharina Junghans, Saskia Rohrbach, Maik Ellies and Rainer Laskawi* Address: Department ... Facial pain in a case of cranial dystonia: a case report. Cephalalgia 1998, 18:709-711. 7. Cheshire WP, Abashian SW, Mann JD: Botulinum toxin in the treatment of myofascial p...

Ngày tải lên: 12/08/2014, 00:20

... by the use of the formal device of functional un- certainty, as defined by Kaplan and Zaenan [3] and Kaplan and Maxwell [2]. In this paper, we relate this characterization to that provided ... consequence of this result is that we can obtain these analyses without going outside the power of TAG and thus staying within the class of con- strained grammatical formalisms charac...

Ngày tải lên: 21/02/2014, 20:20

... Thus, it appears that the a and b immunoreactive bands, ran- ging from 80 to 50 kDa, correspond to the apparent molecular mass of intact rat CGA (with and without post-translational modifications), as ... blot) and MS analysis (TOF-TOF MS) allowed us to investigate the N-terminal processing of CGA in rat heart extracts. Our data reveal the pres- ence of several vasostatin I-containi...

Ngày tải lên: 07/03/2014, 12:20

... efficiencies intherangeof10 7 M )1 Æs )1 for UMP and CMP, and of 10 5 M )1 Æs )1 for AraCMP, L -3TCMP and dCMP (Table 1). Careful characterization of the reaction catalysed by human UMP-CMP kinase indicated that ... a number of years as well as analogs with an L -conformation in the sugar like L -3TC. All of these analogs are delivered as nucleosides to the patients and need...

Ngày tải lên: 08/03/2014, 02:20