0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " Improvement of primary care for patients with chronic heart failure: A study protocol for a cluster randomised trial comparing two strategies" pps

báo cáo khoa học:

báo cáo khoa học: " Improvement of primary care for patients with chronic heart failure: A study protocol for a cluster randomised trial comparing two strategies" pps

... 6:28http://www.implementationscience.com/content/6/1/28Page 5 of 7 STUDY PROT O C O L Open Access Improvement of primary care for patients with chronic heart failure: A study protocol for a cluster randomised trial comparing two strategiesJan van ... Majeed A, Williams J, de Lusignan S, Chan T: Management of heart failurein primary care after implementation of the National Service Framework for Coronary Heart Disease: a cross-sectional study. ... for Heart and LungTransplantation; Heart Rhythm Society: ACC/AHA 2005 Guideline Update for the Diagnosis and Management of Chronic Heart Failure in theAdult: a report of the American College of...
  • 7
  • 295
  • 1
Báo cáo khoa học:

Báo cáo khoa học: "Relationship of cognitive function in patients with schizophrenia in remission to disability: a cross-sectional study in an Indian sample" pps

... Hospital, Tardeo, Mumbai, IndiaEmail: Rajeev Krishnadas* - Rajeev.krishnadas@gmail.com; Brian P Moore - pbrianm@aol.com; Ajita Nayak - ajitanayak@rediffmail.com; Ramesh R Patel - drrrpatel@hotmail.com* ... Ajita Nayak2 and Ramesh R Patel3Address: 1Tranwell Unit, Queen Elizabeth Hospital, Gateshead, Tyne and Wear, UK, 2BYL Nair Hospital, AL Nair Road, Mumbai, India and 3Bhatia Hospital, ... 2.267).Details of medication are shown in Table 1. A total of 96% of the patient group was on a typical antipsychotic, and anequal number were on an anticholinergic medication.32% of the patients...
  • 8
  • 397
  • 0
báo cáo hóa học:

báo cáo hóa học:" Physician-estimated disease severity in patients with chronic heart or lung disease: a cross-sectional analysis" ppt

... just a little better thanaverage. As expected, the predicted risks of hospitalizationand death were also lowest among patients with asthma.Because patients with chronic heart or lung disease ... physicians' and patients& apos;assessment of patients& apos; health, with patients& apos; affectivestate, somatization, and language of interview furtherinfluencing this discordance [13].One reason for ... and interpreta-tion of data. FDW conceptualized the rationale and design of the study and performed the statistical analysis. Allauthors read and approved the final manuscript.AcknowledgementsThis...
  • 9
  • 337
  • 0
Báo cáo khoa học: Improvement of ecdysone receptor gene switch for applications in plants: Locusta migratoria retinoid X receptor (LmRXR) mutagenesis and optimization of translation start site pptx

Báo cáo khoa học: Improvement of ecdysone receptor gene switch for applications in plants: Locusta migratoria retinoid X receptor (LmRXR) mutagenesis and optimization of translation start site pptx

... for mutagenesis were as follows:LmS12 2A (F), CTTGGCTGCTTGCGAGCTGTTATTCTTTTCAATCC; LmS12 2A (R), GGATTGAAAAGAATAACAGCTCGCAAGCAGCCAAG; LmA105S (F), TTGACAGAACTGGTATCAAAGATGAGAGAAATG; LmA105S(R), ... Easy vector to verify the integration of the Kozaksequences. The PCR primers used were as follows: KZK-LUC2 (F), CTCGAGAAAAATGGAAGACGCCAAAAACATAAAG; KZKLUC4 (F), CTCGAGAACCATGGAAGACGCCAAAAACATAAAG; ... CAGATCGATGTGAAAATGATGCAATTAGCAGTTC; Lm V123I (F), TGGCTGCTTGCGATCTATTATTCTTTTCAATCC; Lm V123I(R), GGATTGAAAAGAATAGATCGCAAGCAGCCA.Screening of LmRXR mutants in tobaccoprotoplastsThe LmRXR mutants...
  • 11
  • 461
  • 0
Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf

Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf

... site adjacent to theATG start codon and SacI downstream of the TAA stopcodon for easy cloning in the forward and reverse primers,respectively (forward, 5¢-ctc gag ATG AAG AGA ACACAT TTG GCA-3¢; ... starting quantity of the a- tubulin gene, which is assumed to be at a constantlevels in all the samples. The Arabidopsis (forward, 5¢-AAGGCT TAC CAC GAG CAG CTA TCA-3¢; reverse, 5¢-ACAGGC CAT GTA CTT ... TCT-3¢) and tobacco(forward, 5¢-ATG AGA GAG TGC ATA TCG AT-3¢;reverse, 5¢-TTC ACT GAA GGT GTT GAA-3¢) a- tubulin-specific primers amplified a 108 bp and a 240 bp fragment,respectively.AcknowledgementsWe...
  • 16
  • 454
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Improvement of a Whole Sentence Maximum Entropy Language Model Using Grammatical Features" potx

... traditional way.3 The grammatical featuresThe main goal of this paper is the incorporation of gramatical features to the WSME. Grammaticalinformation may be helpful in many aplications of ... corpus was automatically labelled and man-ually checked. There were two kinds of labelling:POStag labelling and syntactic labelling. ThePOStag vocabulary was composed of 45 labels.The syntactic ... from a training sample. Each word in thetraining sample has a part -of- speech tag (POStag)associated to it. These POStags are considered asword categories and are the terminal symbols of our...
  • 8
  • 332
  • 0
báo cáo khoa học:

báo cáo khoa học:" Improvement of chronic facial pain and facial dyskinesia with the help of botulinum toxin application" ppt

... report Improvement of chronic facial pain and facial dyskinesia with the help of botulinum toxin applicationKatharina Junghans, Saskia Rohrbach, Maik Ellies and Rainer Laskawi*Address: Department ... Facial pain in a case of cranialdystonia: a case report. Cephalalgia 1998, 18:709-711.7. Cheshire WP, Abashian SW, Mann JD: Botulinum toxin in thetreatment of myofascial pain syndrome. Pain ... reproducibletrials of the application of BTX -A for various forms of headache have been conducted to date nor has the mech-anism of action for pain application been conclusivelyproven. For these reasons,...
  • 5
  • 246
  • 1
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "TREATMENT OF LONG DISTANCE DEPENDENCIES IN LFG AND TAG: FUNCTIONAL UNCERTAINTY IN LFG IS A COROLLARY IN TAG" ppt

... by the use of the formal device of functional un- certainty, as defined by Kaplan and Zaenan [3] and Kaplan and Maxwell [2]. In this paper, we relate this characterization to that provided ... consequence of this result is that we can obtain these analyses without going outside the power of TAG and thus staying within the class of con- strained grammatical formalisms characterized as mildly ... The functional uncertainty approach may be characterized as a localization of the long dis- tance dependencies; a localization at the level of f- structures rather than at the level of c-structures....
  • 8
  • 608
  • 0
Báo cáo khoa học: Characterization of natural vasostatin-containing peptides in rat heart docx

Báo cáo khoa học: Characterization of natural vasostatin-containing peptides in rat heart docx

... Thus,it appears that the a and b immunoreactive bands, ran-ging from 80 to 50 kDa, correspond to the apparentmolecular mass of intact rat CGA (with and withoutpost-translational modifications), as ... blot) and MS analysis (TOF-TOF MS)allowed us to investigate the N-terminal processing of CGA in rat heart extracts. Our data reveal the pres-ence of several vasostatin I-containing and vasosta-tin ... whole heart preparations of eel, frog and rat (i.e. negative inotropism and anti-adrenergic activity), we investigated the presence of vasostatin-containingpeptides in rat heart. Rat heart extracts...
  • 11
  • 366
  • 0
Báo cáo khoa học: Reaction of human UMP-CMP kinase with natural and analog substrates docx

Báo cáo khoa học: Reaction of human UMP-CMP kinase with natural and analog substrates docx

... efficienciesintherangeof107M)1Æs)1 for UMP and CMP, and of 105M)1Æs)1 for AraCMP,L-3TCMP and dCMP (Table 1).Careful characterization of the reaction catalysed byhuman UMP-CMP kinase indicated that ... a number of years as well as analogs with anL-conformation in the sugar likeL-3TC. All of these analogsare delivered as nucleosides to the patients and need to bephosphorylated within cells ... P., Krin, E., Danchin, A. ,Sarfati, R. & Barzu, O. (1991) Isolation and characterization of catalytic and calmodulin-binding domains of Bordetella pertussisadenylate cyclase. Eur. J. Biochem....
  • 7
  • 384
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ