cáo khoa học: " Enhancing implementation of tobacco use prevention and cessation counselling guideline among dental providers: a cluster randomised controlled trial" doc
... Murtomaa 1 Abstract Background: Tobacco use adversely affects oral health. Tobacco use prevention and cessation (TUPAC) counselling guidelines recommend that healthcare providers ask about each patient’s ... implementation of tobacco use prevention and cessation counselling guideline among dental providers: a cluster randomised controlled trial....
Ngày tải lên: 10/08/2014, 10:23
... the Tampere and Vaasa municipal dental clinics for generously giving their time for this study. We further thank chief dental officers Eeva Torppa-Saarinen, Anne-Mari Aaltonen, and Jukka Kentala ... measuring all aspects of each dom ain and select the key point of each. The allocation of certain items to domains was not always clear. For example, the item from the domain motiv...
Ngày tải lên: 10/08/2014, 10:23
... cloning, recombinant expression and purification of two new monofunctional FADS enzymes from Arabidopsis thaliana (AtRibF1 and AtRibF2) was achieved by Sandoval et al. [43], as this article was being ... 5.5) and treated with Caylase (Cayla, Tou- lose, France) and pectinase (Sigma-Aldrich), as described in [13]. Intact purified mitochondria and plastids were obtained by protoplast f...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: Enhancing thermostability of maltogenic amylase from Bacillus thermoalkalophilus ET2 by DNA shuffling pdf
... is a reduction in the number of glutamines and asparagines, as these two amino acids are easily deamidated at elevated temperatures [34–36]. Examination of amino acid compositions of the total ... Zhang N, Xiao L, Madison V & Zaks A (2004) Improved activity and thermostability of Candida antarctica lipase B by DNA family shuffling. Protein Eng Des Sel 17, 133–140. 24 Oslanc...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo khoa học: "Enhancing Performance of Lexicalised Grammars" pdf
... models, with and without POS tags as features, were used. While POS taggers such as TreeTagger are com- mon, and there some supertaggers are available, no- tably that of Clark and Curran (2007) ... on Theoretical and Methodological Issues in Machine Translation, Baltimore, USA. Stephan Oepen. 2001. [incr tsdb()] – competence and performance laboratory. User manual, Computational L...
Ngày tải lên: 17/03/2014, 02:20
Báo cáo khoa học: "An Implementation of Combined Partial Parser and Morphosyntactic Disambiguator" pptx
... The Implementation 3.1 Objectives The goal of the implementation was a combined par- tial parser and tagger that would be reasonably fast, but at the same time easy to modify and maintain. At the ... forms and a list of interpre- tations; for group — number of heads of the group and lists of interpretations of syntactic and semantic head. Every interpretation con...
Ngày tải lên: 31/03/2014, 01:20
báo cáo khoa học: " The implementation of a translational study involving a primary care based behavioral program to improve blood pressure control: The HTN-IMPROVE study protocol " pot
... organizational model of implementation suitable for complex innovations and adapted to the context of clinical practice. An additional product of this phase of the study is an evaluation of approaches ... three phases: data coding, within-case analysis, and between- case analysis. In the first phase, we use qualitative data analysis software (ATLAS.ti 5.2) to code the study...
Ngày tải lên: 10/08/2014, 10:23
Tài liệu Báo cáo khoa học: Functional hierarchy of plasminogen kringles 1 and 4 in fibrinolysis and plasmin-induced cell detachment and apoptosis docx
... Montes R, Paramo JA, Angles-Cano E & Rocha E (1996) Development and clinical application of a new ELISA assay to determine plasmin-alpha2-antiplasmin complexes in plasma. Br J Haematol 92, ... cells; lane 5, Glu-Pg- and mAb A1 0.2-treated cells; lane 6, Glu-Pg- and mAb 34D3-trea- ted cells. Bands in lanes 1 and 2 correspond to forms I and II of plasmin(ogen). High molecul...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: Transactivation properties of c-Myb are critically dependent on two SUMO-1 acceptor sites that are conjugated in a PIASy enhanced manner pptx
... the activity of the factor. Even a conservative mutation (KfiR) keeping the charge unchanged, causes a large enhancement of the activity of c-Mybbothintransfectionassaysandwhenactivationofan endogenous ... divided withonethirdusedforpreparationofthetotalfraction(T)andthe remaining two-thirds used to make the soluble and nuclear matrix fraction. Total protein concentration of the...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: Domain IV of mouse laminin b1 and b2 chains Structure, glycosaminoglycan modi®cation and immunochemical analysis of tissue contents pptx
... Germany). T he sense and antisense primers for b1 were GTCAGCTAGCTAACGAGGTGG AGTCCGGTTAC and GTCACTCGAGCTAAAGGCC CGTCTGGTGAATCAAG, respectively, and for b2GTC AGCTAGCCCGTCCCTGTGACTGTGATG and ... generated rabbit antisera against recombinant mouse b1IV and b2IV. These antisera had high titers (half-maximal binding) at dilutions of 1 : 4000 (anti- b1) and 1 : 20 000 (anti-b2) in E...
Ngày tải lên: 21/02/2014, 03:20