báo cáo khoa học: " Making sense of health information technology implementation: A qualitative study protocol" ppsx
báo cáo khoa học: " Making sense of health information technology implementation: A qualitative study protocol" ppsx
... healthcare professionals ‘make sense of anelectronic patient record adoption. Information Systems Management 2007,24:29-42.44. Apker J: Sensemaking of change in the managed care era: A case ... teams’ sensemaking and action as the teamprepares to implement new information technology in a tiertiary care hospital. Based on management andhealthcare literature on HIT implementation and ... between-case analyses. To describe and comparesensemaking across multidisciplinary project teams, datawill be analyzed for each case study sub-team so that wecan gain a rich understan ding of the sensemaking...
- 8
- 438
- 1
Báo cáo khoa học: "Making Sense of Sound: Unsupervised Topic Segmentation over Acoustic Input" docx
... (Malioutov and Barzilay, 2006). This mate-rial is a particularly appealing application area for anaudio-based segmentation algorithm — many aca-demic subjects lack transcribed data for training,while ... Acoustic InputIgor Malioutov, Alex Park, Regina Barzilay, and James GlassMassachusetts Institute of Technology {igorm,malex,regina,glass}@csail.mit.eduAbstractWe address the task of unsupervised ... high word error rate.1 IntroductionAn important practical application of topic segmen-tation is the analysis of spoken data. Paragraphbreaks, section markers and other structural cuescommon...
- 8
- 351
- 0
Báo cáo khoa học: Making sense of G-quadruplex and i-motif functions in oncogene promoters pot
... Samantha Kendrick3and Laurence Hurley1,2,31 University of Arizona, College of Pharmacy, Tucson, USA2 University of Arizona, BIO5 Institute, Tucson, USA3 University of Arizona, Arizona Cancer ... occurrence and structural uniqueness of a G-quadruplex in the human c-kit promoter. NucleicAcids Res 35, 5799–5808.21 Hsu ST, Varnai P, Bugaut A, Reszka AP, Neidle S &Balasubramanian S (2009) A ... binding of WT-1 and abro-gates the transcriptional repression, thereby allowingactivation of Bcl-2 transcription. Although a number of whole-genome studies have demonstrated a poten-tial activating...
- 11
- 366
- 0
báo cáo khoa học: "Improved delivery of cardiovascular care (IDOCC) through outreach facilitation: study protocol and implementation details of a cluster randomized controlled trial in primary care" doc
... Medicine,University of Ottawa, Ottawa, Ontario, Canada.3Institute of Population Health, University of Ottawa, Ottawa, Ontario, Canada.4School of Primary Health Care, Monash University, Victoria, Australia.5Southern ... Ottawa, Ontario, Canada.10Department of Epidemiologyand Community Medicine, University of Ottawa, Ottawa, Ontario, Canada.11Telfer School of Management, University of Ottawa, Ottawa, Ontario,Canada.Authors’ ... of Ottawa, Ottawa, Ontario, Canada.8Department of Medicine, Division of Nephrology, University of Ottawa,Ottawa, Ontario, Canada.9Clinical Epidemiology Program, Ottawa HospitalResearch Institute,...
- 14
- 415
- 0
báo cáo khoa học: " Determining research knowledge infrastructure for healthcare systems: a qualitative study" pptx
... McMaster University. Hamilton, Ontario, Canada.5Department of Political Science, Université Laval, Quebec, Quebec City, Canada.6Ottawa Health Research Institute, Ottawa, Ontario, Canada.Authors’ ... (or that are linked to such organisations).We identified a sample of these organisations by exam-ining the publicly available list of participants that havebeen a part of the Canadian Health ... ResearchFoundation’s Executive Training for Research Applica-tion program. This program is geared towards health system managers and policy makers in Canadian health system organisations and aims...
- 5
- 617
- 0
Báo cáo sinh học: "Making sense of centromeres" doc
... 5. Talbert PB, Masuelli R, Tyagi AP, ComaiL, Henikoff S: Centromeric localiza-tion and adaptive evolution of anArabidopsis histone H3 variant. PlantCell 2002, 14:1053-1066.Pete Moore is a ... rapid evolution might be adaptive, as with CenH3.We decided that a more thorough comparison of plant and animal Cenpcand CenH3 genes was warranted. It took us about two years from theinitial ... becomes packaged ready for use insexual reproduction. It has always been a puzzle that sexual reproductioncreates a scenario in which a parentthrows its genes into a new individualwith only a 50:50...
- 4
- 318
- 0
Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt
... Dynamic model-theoretic semantics allows the evaluation of a formula to cause the addition of information to the model. This interaction of the evaluation of a formula and the expansion of ... models are incomplete models that include only the information needed for an application and to which information can be added. Dynamic models are basically approximations of larger conventional ... semantics provides a computationally attractive means of representing the semantics of natural language. However, the models used in this formalism are static and are usually infinite. Dynamic...
- 3
- 394
- 0
Báo cáo khoa học: Catalytic digestion of human tumor necrosis factor-a by antibody heavy chain pot
... cleaved peptide bondsare indicated by arrows. Cleavage at Gln21-Ala22 gave a band at15 kDa in SDS ⁄ PAGE. Cleavages at Leu36-Leu37 and Asn40-Gly41gave a band at 13 kDa. The cleaved Gln21-Ala22 ... Lancet 351, 1731.17 D’Alessandria C, Malviya G, Viscido A, Aratari A, Maccioni F, Amato A, Scopinaro F, Caprilli R &Signore A (2007) Use of a 99mTc labeled anti-TNFal-pha monoclonal antibody ... decade has seen the preparation of many naturalcatalytic antibodies. The first natural catalytic anti-body isolated from the serum of an asthma patientwas reported by Paul et al. [1]. The catalytic...
- 10
- 491
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... CGGAAACGCCTTAAGTCCAG GCCACAATCCAGTCATTCCA 83MT 2A AATAAGCTTCCGACTCTAGCCGC GATAAGCTTGTGGAAGTCGCGT 259CD237904 AGCTGGTGCAGGAGGAAGTA TCTCACTGGCCCTAAACTGG 92AL707095 CCGAGAACCGAACTTACCAA CTGATAGGGGTTGGGTGATG ... (5¢-to3¢)Size(bp)MDR1 GAAGAAGGGCCAGACGC CTCCTGGGACACGATGC 178MRP1 CCTTCGCTGAGTTCCTGC CTGCGGTGCTGTTGTGG 246BCRP ACATCAGCGGATACTACAGAG CACCATCATAAGGGTAAACAT 173CA9 TTTGAATGGGCGAGTGATTG ACAGCAAAAAGGAGGCCAAA 138BMP2 ... CTGATAGGGGTTGGGTGATG 128AK095731 AGGAAGCACCCAGCAATACCA GCATTTCCATTTCCCTAAGCAC 109DKK1 CACCTTGGATGGGTATTCCA CAACACAATCCTGAGGCACA 114BC037851 CACAGCTCCCATTCATTCCA TCCCTTTGCCTCCTGTTGTT 107b-Actin TCCTCCCTGGAGAAGAGCTA...
- 13
- 563
- 0
Báo cáo khoa học: Secondary structure of lipidated Ras bound to a lipid bilayer pptx
... of Ras at the air–waterinterface was analysed. With the largely increasedsignal-to-noise ratio of ATR-FTIR, we have, for theTable 1. X-Ray and NMR-based secondary structure of Ras in comparison ... filtra-tion, using AmiconÒ concentrators. All protein batcheswere analysed by SDS-PAGE and MALDI-TOF-MS.Preparation of the ATR crystalThe germanium IRE of the ATR was cleaned chemicallywith a ... 2630–2637.25 Abankwa D, Hanzal-Bayer M, Ariotti N, Plowman SJ,Gorfe AA, Parton RG, McCammon JA & Hancock JF(2008) A novel switch region regulates H-ras membraneorientation and signal output....
- 9
- 484
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ