báo cáo khoa học: " ’To take care of the patients’: Qualitative analysis of Veterans Health Administration personnel experiences with a clinical informatics system" ppsx

... article as: Bonner et al.: ’To take care of the patients’: Qualitative analysis of Veterans Health Administration personnel experiences with a clinical informatics system. Implementation Science 2010 ... 5:63 http://www.implementationscience.com/content/5/1/63 Page 8 of 8 RESEARC H ARTIC LE Open Access ’To take care of the patients’: Qual...

Ngày tải lên: 10/08/2014, 10:23

... TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a GSP-...

Ngày tải lên: 14/02/2014, 14:20

... most of the protein components are integral in the membrane, most of these mitochondrial pro- teins behave as if they have a- helical transmembrane domains, rather than b-barrels. These proteins are ... mitochondrial outer membrane The data presented here show that most of the protein associated with the yeast mitochondrial outer mem- brane in yeast is integral in the mem...

Ngày tải lên: 19/02/2014, 07:20

... of Ca 2+ channels, either localized in the membranes of intracellular Ca 2+ stores or in the plasma membrane. Such Ca 2+ entry channels in the plasma membrane and Ca 2+ release channels in intracellular ... pharmaceutical applications as compared to the cADPR analogues available so far. Conclusion Although the molecular mechanism of receptor-medi- ated formation of cADPR is...

Ngày tải lên: 20/02/2014, 01:20

... quenched-flow analysis reveals that ChlH dramat- ically accelerates the formation and breakdown of an intermediate in the catalytic cycle of ChlM. In light of the profound effect that ChlH has on the methyltransferase ... curve. The maximum rate during an assay was taken as the steady-state rate and occurred at the beginning of the reaction. Quenched-flow measurements...

Ngày tải lên: 20/02/2014, 02:21

... FEBS Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid Yang Chen, Ravi Kiran Koripella, Suparna Sanyal and Maria Selmer Department of Cell and Molecular ... linker has flipped away to create the 40 A ˚ shift of domain IV relative to domain III Mutation to a larger side chain may change the relative positions of domain III and V...

Ngày tải lên: 06/03/2014, 22:21

... C-terminal part appears to play an essential role in retaining Toc75 at the outer chloroplast membrane [35]. With the exception of atToc75-I (At1g35860 ⁄ 80), all A. thaliana Toc75 paralogs are expressed ... state and do not give any clues on the activation mechanism. As a result of crystal and biochemical studies on the Toc33 homodimer, a significant advance in the under-...

Ngày tải lên: 07/03/2014, 03:20

... NaN 3 . Traces are the average of duplicates. The precipitation of ADH was completely suppressed at an Hsp25 : ADH ratio of 1.4 : 1.0. The Q19 4A mutant showed comparable chaperone activity with the ... precipitation to the wild-type protein. Taken together, the thermal and reduction stress assays demonstrate that each of the glutamic acid mutants, in particular E19 0...

Ngày tải lên: 07/03/2014, 04:20

... vector The gene coding for Lys33GP was constructed by the SOE- PCR strategy, using primer 1 (5¢-GTGAATTC CTGGAAG TTCTGTTCCAGGGGCCCAGCAGCGATGAACCGAG CGAAAGCAGCGAACCGAGCTGCGATAGCAGC-3¢) and primer ... N-terminal sequence (IPPQCH) of BBI, was paired with the abridged universal amplification primer. The 3¢-end partial cDNA of BBI was then amplified by PCR. The PCR product contain- i...

Ngày tải lên: 15/03/2014, 09:20

... of a case grammar. This leads to a correspondence between roles in the net and surface cases within the sentence. Cases of a case grammar at the one hand show regularities in their relation ... University of Vienna, Austria ABSTRACT This paper describes the structure and evaluation of the syntactico-semantic lexicon (SSL) of the German Natural Language Un...

Ngày tải lên: 01/04/2014, 00:20