báo cáo khoa học: "Healthcare professionals'''''''' intentions to use wiki-based reminders to promote best practices in trauma care: a survey protocol" doc

báo cáo khoa học: "Healthcare professionals'''' intentions to use wiki-based reminders to promote best practices in trauma care: a survey protocol" doc

báo cáo khoa học: "Healthcare professionals'''' intentions to use wiki-based reminders to promote best practices in trauma care: a survey protocol" doc

... [38]. According to a survey of trauma coordinators and nurse managers caring for traumatic brain injury victims in the United States, adherence to clinical practice guide- lines has improved in ... 10.1186/1748-5908-5-45 Cite this article as: Archambault et al., Healthcare professionals' intentions to use wiki-based reminders to promote best practices in...

Ngày tải lên: 10/08/2014, 10:23

9 461 0
báo cáo khoa học: " Healthcare professionals'''' intentions to use clinical guidelines: a survey using the theory of planned behaviour" doc

báo cáo khoa học: " Healthcare professionals'''' intentions to use clinical guidelines: a survey using the theory of planned behaviour" doc

... Duodecim, Kalevankatu 1 1A, Helsinki, Finland and 5 The Ministry of Social Affairs and Health, Meritullinkatu 8, Helsinki, Finland References 1. Davis DA, Taylor-Vaisey A: Translating guidelines into ... cited. Research article Healthcare professionals' intentions to use clinical guidelines: a survey using the theory of planned behaviour Tiina Kortteisto* 1 , Minna Kaila...

Ngày tải lên: 10/08/2014, 10:23

10 290 0
báo cáo khoa học: " Healthcare professionals'''' intentions and behaviours: A systematic review of studies based on social cognitive theories" pot

báo cáo khoa học: " Healthcare professionals'''' intentions and behaviours: A systematic review of studies based on social cognitive theories" pot

... of Medicine, University of Ottawa, Ontario, Canada Email: Gaston Godin* - Gaston.Godin@fsi.ulaval.ca; Ariane Bélanger-Gravel - Ariane.belanger-gravel@fsi.ulaval.ca; Martin Eccles - martin.eccles@newcastle.ac.uk; ... of research findings into practice does not happen as readily as desired [1], and many authors have documented gaps between evidence-based practices and the routine clinical pr...

Ngày tải lên: 11/08/2014, 16:21

12 338 0
báo cáo khoa học: " Can patient decision aids help people make good decisions about participating in clinical trials? A study protocol" pptx

báo cáo khoa học: " Can patient decision aids help people make good decisions about participating in clinical trials? A study protocol" pptx

... participate in a clinical trial. Furthermore, the related findings that DAs improve understanding, that improved understanding can increase trial participation rates [47-50], and that DAs can increase ... Kimmelman - jonathan.kimmelman@mcgill.ca; Raphael Saginur - rsaginur@ottawahospital.on.ca * Corresponding author Abstract Background: Evidence shows that the standard process for obtai...

Ngày tải lên: 11/08/2014, 16:21

11 288 0
báo cáo khoa học: "The occurrence and management of fluid retention associated with TKI therapy in CML, with a focus on dasatinib" pptx

báo cáo khoa học: "The occurrence and management of fluid retention associated with TKI therapy in CML, with a focus on dasatinib" pptx

... effects associated with imatinib intolerance is minimal, indicating that there is a lack of cross-intolerance in patients presenting with imatinib intolerance. After 8 months of follow-up in the ... discontinuation rates for dasatinib in patients intolerant to imatinib due to hepatotoxicity (0%), rash (1%), and cytopenias (6%) remained low [23]. Pleural Effusion The incidences of...

Ngày tải lên: 10/08/2014, 22:20

6 338 0
báo cáo khoa học: " Delivering the WISE (Whole Systems Informing Self-Management Engagement) training package in primary care: learning from formative evaluation" ppsx

báo cáo khoa học: " Delivering the WISE (Whole Systems Informing Self-Management Engagement) training package in primary care: learning from formative evaluation" ppsx

... study and its eva- luation was to refine the training package in such a way as to make the training in the definitive study workable, effective, and to fulfil the aim of enabling the WISE approach ... the post-training recordings were examined. The analysis of this data was undertaken at two levels: A narrative overview reading to capture the use of WISE tools, and a fine...

Ngày tải lên: 11/08/2014, 16:20

15 259 0
báo cáo khoa học: " HIV and hepatitis C virus infections among hanka injection drug users in central Ukraine: a cross-sectional survey" ppt

báo cáo khoa học: " HIV and hepatitis C virus infections among hanka injection drug users in central Ukraine: a cross-sectional survey" ppt

... University of Alabama at Birmingham, Birmingham, Alabama, USA and 5 Vinnitsya National Medical University – Pirogov, Vinnitsya, Ukraine Email: Kostyantyn V Dumchev - k.dumchev@gmail.com; Ruslan Soldyshev ... Grant 5D43TW05815, UAB-Pirogov-NDRI-Substance Abuse ICOHRTA In Ukraine (International Clinical, Operational and Health Services Research Training Award). The funder did not play a...

Ngày tải lên: 11/08/2014, 18:20

9 331 0
Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

Tài liệu Báo cáo khoa học: Enhanced thermostability of methyl parathion hydrolase from Ochrobactrum sp. M231 by rational engineering of a glycine to proline mutation pdf

... MPH a Forward: 5¢-TAGAATTCGCTGCTCCACAA GTTAGAACT-3¢ Reverse: 5¢-TA GCGGCCGCTTACTTTGGGTTA ACGACGGA-3¢ Mutant MPH b G194P 5¢-CCTGACGATTCTAAACCGTTCTTCAAGGGTGCC-3¢ G198P 5¢-AAAGGTTTCTTCAAG CCGGCCATGGCTTCCCTT-3¢ G194P ... soil at a pesticide factory in Tianjin, China, and stored in our laboratory [7]. The E. coli strains JM109 (Promega, Madison, WI, USA) and BL21 (DE3) (Nov- agen, Darmstad...

Ngày tải lên: 15/02/2014, 01:20

8 740 0
Tài liệu Báo cáo khoa học: The heat shock factor family and adaptation to proteotoxic stress pdf

Tài liệu Báo cáo khoa học: The heat shock factor family and adaptation to proteotoxic stress pdf

... Fujimoto M, Sugahara K, Yamada S, Shinkai Y, Oka Y, Katoh Y & Nakai A (2003) Activation of heat shock genes is not necessary for protection by heat shock transcription factor 1 against cell death ... suggests a new regulatory pathway. Mol Cell Biol 13, 1983–1997. 24 Nakai A, Tanabe M, Kawazoe Y, Inazawa J, Morimoto RI & Nagata K (1997) HSF4, a new member of the human heat shock...

Ngày tải lên: 18/02/2014, 04:20

14 688 0
w