báo cáo khoa học: " The health disparities cancer collaborative: a case study of practice registry measurement in a quality improvement collaborative" pot

... 10.1186/1748-5908-5-42 Cite this article as: Haggstrom et al., The health disparities cancer collabora- tive: a case study of practice registry measurement in a quality improvement collaborative Implementation Science ... screening measures captured improvement among a minority of health centers. Indi- vidual health centers acting alone may not have ad...

Ngày tải lên: 10/08/2014, 10:23

... and distal causes; proximal factors act directly to cause disease or health gains, and distal determinants are further back in the causal chain and act via (a number of) intermediary causes [5]. In addition, ... is called the 'virtual water' contained in that commodity. There- fore, the increasing global trade of commodities is accom- panied by an increasing global...

Ngày tải lên: 11/08/2014, 18:20

... encompasses the amino-terminal transactiva- tion domain and Pointed domain fused to a nuclear localization signal and presumably acts as a dominant negative ESE-1 due to its ability to interact ... #4, 5¢-AGGGGAGAGGAGGG TTAAATTTGTGGGGGGTA CGAAAAGGCGG-3¢; (e) COX-2 promoter Ets site #5: 5¢-GGGTTTTTTACCCACG CTAATGAGAAAATCGGAA ACC-3¢. DNA transfection assays Cotransfections were carried ou...

Ngày tải lên: 19/02/2014, 17:20

... MSA, but the main problem is the lack of dialectal training data. 2 In this paper, we present our efforts to create a dataset of dialectal Arabic, the Arabic Online Commentary Dataset, by extracting ... MSA content significantly dominates dialectal content, and in turn MSA dominates in datasets available for linguistic research, especially in textual form. The abundance...

Ngày tải lên: 20/02/2014, 04:20

... extensive electrostatic interactions and stacking contacts. The rest of RPA70, as well as its DNA-binding domain, interact with protein partners that are involved in DNA repair, recombination and replication pathways (Fig. ... Shirakawa M & Tanaka K (1996) Identification of a damaged-DNA binding domain of the XPA protein. Mutat Res 362, 87–95. 27 Ikegami T, Kuraoka I, Saijo M...

Ngày tải lên: 07/03/2014, 12:20

... spectra were acquired by using Varian Inova-500M NMR equipped with a 4 mm gHX Nanoprobe (Varian NMR Inc., Palo Alto, CA). The sample was spinning at 2000 Hz at a temperature of 21 °C. An interpulse ... Animal Care and Use Committee. All animal experimentation des- cribed was conducted in accord with accepted standards of humane animal care, as outlined in the ethical guideline...

Ngày tải lên: 07/03/2014, 21:20

... suggesting that GBE50 prevented the harm caused by an HFD. In addition, we found no significant alterations in the levels of alanine aminotransferase, aspartate amino- transferase or creatinine kinase ... g) were obtained from Shanghai Laboratory Animal Center of the Shanghai Institute of Biological Sciences, Chinese Acad- emy of Sciences (Shanghai, China). Animals were house...

Ngày tải lên: 16/03/2014, 04:20

... that activators and blockers of BK Ca channels may have application as neuroprotectants or as therapeutics in certain disease states, including vascular dysfunction, urinary disease, and certain seizure ... to 25 lm in sterile water and loaded into a 0.1 cm rect- angular quartz cell for analysis. Final spectra were the average of eight scans obtained using a scan rate of 20 nm...

Ngày tải lên: 16/03/2014, 06:20

... 5¢-GATCCCGTATATGATA CCAACAGTAATTC AAGAGATTACTGTTGGTATCA TATACGTTTTCA-3¢; antisense, 5¢-AGCTTT GAAAACG TATATGATACCAACAGTAATCTCTTGAATTACTGT TGGTATCATATACGGG-3¢; negative shRNA: sense, 5¢-G ATCCGACTTCATAAGGCGACTGCT ... 5¢-GATCCTCTGCGAGGTTGTC TGCTATTCAAGAGATAGCAGACAACCTCGCAGAT CA-3¢; antisense, 5¢-AGCTTGATCTGCGAGGTTGTCTG CTATCTCTTGA ATAGCAGACAACCTCGCAGAG-3¢; HMGN2-shRNA-2: sense, 5¢-GATCCA AATGGA...

Ngày tải lên: 22/03/2014, 16:20

... phase was a slight increase in the absorbance at wavelengths above 650 nm, indicating the accumulation of a small amount of CT2 at the end of the reaction (Fig. 4A) . The analysis of a series of shots ... consisted of a further bleaching of the a- vin main absorbance band (at 450 nm) with a concom- itant decrease in the absorbance band around 550 nm....

Ngày tải lên: 23/03/2014, 05:22