báo cáo khoa học: " The health disparities cancer collaborative: a case study of practice registry measurement in a quality improvement collaborative" pot

... 10.1186/1748-5908-5-42Cite this article as: Haggstrom et al., The health disparities cancer collabora-tive: a case study of practice registry measurement in a quality improvement collaborative Implementation Science ... screening measures captured improvement among a minority of health centers. Indi-vidual health centers acting alone may not have adequateTable 5: Changes from baseline to final measurement in the ... moredistal to the initial screening event, the number of health centers reporting practice registry data decreased, and the size of the detectable change increased. In the HDCC,reporting practice registry...

báo cáo khoa học: " The health impacts of globalisation: a conceptual framework" docx

... anddistal causes; proximal factors act directly to cause diseaseor health gains, and distal determinants are further back in the causal chain and act via (a number of) intermediarycauses [5]. In addition, ... is called the 'virtual water' contained in that commodity. There-fore, the increasing global trade of commodities is accom-panied by an increasing global trade in virtual water. The global ... human health: a global indicator analysis.International Journal Of Environmental Health Research 2004, 14:13-30.42. Collins T: Globalization, global health and access to health care. Int J Health...

Tài liệu Báo cáo khoa học: The Ets transcription factor ESE-1 mediates induction of the COX-2 gene by LPS in monocytes doc

... encompasses the amino-terminal transactiva-tion domain and Pointed domain fused to a nuclearlocalization signal and presumably acts as a dominantnegative ESE-1 due to its ability to interact ... #4,5¢-AGGGGAGAGGAGGGTTAAATTTGTGGGGGGTACGAAAAGGCGG-3¢; (e) COX-2 promoter Ets site #5:5¢-GGGTTTTTTACCCACGCTAATGAGAAAATCGGAAACC-3¢.DNA transfection assaysCotransfections were carried out in ... #3, 5¢-CGAAAAGGCGGAAAGAAACAGT-3¢; (d) COX-2 promoter Ets site #4, 5¢-GAGAGGAGGGAAAAATTTGTGG-3¢;3¢-CTCTCCTCCCTTTTTAAACACC-5¢; (5) COX-2 promoter Ets site #5,5¢-TCTCATTTCCGTGGGTAAAAA-3¢.Site-directed...

Tài liệu Báo cáo khoa học: "The Arabic Online Commentary Dataset: an Annotated Dataset of Informal Arabic with High Dialectal Content" pdf

... MSA, but the main problem is the lack of dialectal training data.2 In this paper, we present our efforts to create a dataset of dialectal Arabic, the Arabic OnlineCommentary Dataset, by extracting ... MSA contentsigniﬁcantly dominates dialectal content, and in turnMSA dominates in datasets available for linguisticresearch, especially in textual form. The abundance of MSA data has greatly ... (also taking a crowdsourcing approach)to aid machine translation of dialectal Arabic.Given the recent political unrest in the MiddleEast (early 2011), another rich source of dialectalArabic...

Báo cáo khoa học: The protein shufﬂe Sequential interactions among components of the human nucleotide excision repair pathway pdf

... extensiveelectrostatic interactions and stacking contacts. The rest of RPA70, as well as its DNA-binding domain,interact with protein partners that are involved in DNA repair, recombination and replication pathways(Fig. ... Shirakawa M & Tanaka K (1996) Identiﬁcation of a damaged-DNA binding domain of the XPA protein.Mutat Res 362, 87–95.27 Ikegami T, Kuraoka I, Saijo M, Kodo N, Kyogoku Y,Morikawa K, Tanaka K ... have emphasized that components of the NER process interact with one another in a dynamic manner and participate in other DNA meta-bolizing pathways using their diverse structuraldomains. The...

Báo cáo khoa học: The cytochrome P450scc system opens an alternate pathway of vitamin D3 metabolism docx

... spectra wereacquired by using Varian Inova-500M NMR equipped with a 4 mm gHX Nanoprobe (Varian NMR Inc., Palo Alto,CA). The sample was spinning at 2000 Hz at a temperature of 21 °C. An interpulse ... AnimalCare and Use Committee. All animal experimentation des-cribed was conducted in accord with accepted standards of humane animal care, as outlined in the ethical guidelines. A mitochondrial ... and MS analyses on dryice.Side chain-modiﬁcation of vitamin D3 bymitochondria isolated from the adrenal glandAdrenals were obtained from male Wistar rats aged3 months, killed under anesthesia....

Báo cáo khoa học: Transcriptome proﬁling analysis reveals multiple modulatory effects of Ginkgo biloba extract in the liver of rats on a high-fat diet pdf

... suggestingthat GBE50 prevented the harm caused by an HFD. In addition, we found no signiﬁcant alterations in the levels of alanine aminotransferase, aspartate amino-transferase or creatinine kinase ... g)were obtained from Shanghai Laboratory Animal Center of the Shanghai Institute of Biological Sciences, Chinese Acad-emy of Sciences (Shanghai, China). Animals were housed in a temperature-controlled ... Acacb,Acbd6 (acyl-CoA-binding domain containing 6), Scd2(stearoyl-CoA desaturase 2) or associated genes,Sorbs3 (sorbin and SH3 domain containing 3) andEtnk1_predicted (ethanolamine kinase 1) were...

Báo cáo khoa học: The Janus-faced atracotoxins are speciﬁc blockers of invertebrate KCa channels ppt

... that activators and blockers of BKCachannels may have application as neuroprotectants oras therapeutics in certain disease states, includingvascular dysfunction, urinary disease, and certainseizure ... to 25 lm in sterile water and loaded into a 0.1 cm rect-angular quartz cell for analysis. Final spectra were the average of eight scans obtained using a scan rate of 20 nmÆmin)1and a response ... Initial inactivation resulted in a fast-transient component, with a subsequent late-maintained phase that displayed much slower inactiva-tion kinetics. The IK(Ca)also activated at membranepotentials...

Báo cáo khoa học: The chromosomal protein HMGN2 mediates lipopolysaccharide-induced expression of b-defensins in A549 cells potx

... 5¢-GATCCCGTATATGATACCAACAGTAATTC AAGAGATTACTGTTGGTATCATATACGTTTTCA-3¢; antisense, 5¢-AGCTTT GAAAACGTATATGATACCAACAGTAATCTCTTGAATTACTGTTGGTATCATATACGGG-3¢; negative shRNA: sense, 5¢-GATCCGACTTCATAAGGCGACTGCT ... 5¢-GATCCTCTGCGAGGTTGTCTGCTATTCAAGAGATAGCAGACAACCTCGCAGATCA-3¢; antisense, 5¢-AGCTTGATCTGCGAGGTTGTCTGCTATCTCTTGA ATAGCAGACAACCTCGCAGAG-3¢;HMGN2-shRNA-2: sense, 5¢-GATCCA AATGGAGATGCCAAAACATTCAAGAGATGTTTTGGCATCTCCATTTTCA-3¢;antisense, ... 5¢-GATCCGACTTCATAAGGCGACTGCT TCAAGACGGCATGCGCCTTATGAAGTCTTTTTTGTCGACA-3¢; anti-sense, 5¢-AGCTTAGTTCGACAAAAAAGACTTCTTCATAAGGCGCATGCCGTCTTGAAGCACGCCTTATGAAGT-3¢). The complete HMGN2 cDNA was ampliﬁed...

Báo cáo khoa học: The ferredoxin-NADP+ reductase ⁄ferredoxin electron transfer system of Plasmodium falciparum docx

... phasewas a slight increase in the absorbance at wavelengthsabove 650 nm, indicating the accumulation of a smallamount of CT2 at the end of the reaction (Fig. 4A) . The analysis of a series of shots ... consisted of a further bleaching of the a- vin main absorbance band (at 450 nm) with a concom-itant decrease in the absorbance band around 550 nm.Another spectral change occurring during this phasewas ... site-directedmutagenesis kit (Stratagene, Agilent Technologies, Cernu-sco sul Naviglio, Milano, Italy) and the oligonucleotides5¢-CATATTAAAAAACAACGAGCTGCCAGATTATATTCTATATCC-3¢ (sense primer) and 5¢-GGATATAGAATATAATCTGGCAGCTCGTTGTTTTTTAATATG-3¢...

Xem thêm