báo cáo khoa học: "Upregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and increases proportion of Treg cells" pptx
... al.: Upregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and increases proportion of Treg cells. Journal of Experimental & Clinical Cancer ... Open Access Upregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and...
Ngày tải lên: 10/08/2014, 10:21
... interests The authors declare that they have no competing interests. Authors' contributions AM was involved in conception and writing the manu- script. AM and KK participated in collection ... Sparrow Health System, and HTC and DT are also associate profes- sors at the Michigan State University. Consent Written informed consent was obtained from the patient's next -of- k...
Ngày tải lên: 10/08/2014, 22:20
... event and thus represents a fundamental difference in the reaction mechanism of this RNR and that of other class 1 RNRs or, instead, is a result of the interaction of the R2F with the inactivated ... the putative ribosome binding site but not the promotor) was amplified by PCR using primers OB1 (5¢-TTT TTC TAG AGC AGG GTA GGT TGA TTT CAT GTC GAA TG-3¢; additional XbaI site underl...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx
... CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe 1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ... recon- stitute the activity by using the treatment that suc- cessfully restored the bacterial protein [21,33]. Interestingly, the same difficulty in stripping off the metallo...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... composi- tion. The temperature acclimation pattern of proportional pooling of subunits with different kinetic and thermodynamic properties of the tetrameric enzyme may result in fine-tuning of the ... chan- ged by affecting rates of transcription and ⁄ or transla- tion and ⁄ or mRNA and protein degradation. This represents a quantitative strategy to offset the lack or exces...
Ngày tải lên: 19/02/2014, 02:20
Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx
... family. In this context, it is import- ant to draw attention to the fact that HepG2 cells grown in iron rich media: (a) induced coordinated changes in the expression of the transferrin receptor and ... associated with growth retardation due to a decrease in the percentage of cells in the cycle 4 with concomitant cell arrest in the G1 phase. Overall, and considering t...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx
... by stimulation with serotonin, but is not direct evidence that Ras-GRF1 contributes to the serotonin-induced activation of Ras and ERK1 ⁄ 2. Pretreatment with H89 eliminated the sero- tonin-induced ... [32]. The sero- tonin-induced phosphorylation of Ras-GRF1-D1-225 at Ser916 indicates that the protein is located in cellu- lar compartments within the reach of kinases activated upon...
Ngày tải lên: 19/02/2014, 18:20
Tài liệu Báo cáo khoa học: Enhanced expression of Mcm proteins in cancer cells derived from uterine cervix docx
... Blue staining. Table 2. Quantitation and comparison of proteins in GM and WI-38 cells. From the data in Fig. 2 and others, the concentrations of Mcm proteins, ORC2 and PCNA in total protein and ... probably function in DNA replication, but the role of the proteins not tightly bound to chromatin remains to be determined. Consistent with the results at the protein level...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of flavonol synthase from Citrus unshiu pptx
... Hybridiza- tion of the mismatch primer 5¢-CTCCACCTCCATG GATTTTATTTTCC-3¢ to the FLS 5¢ coding region introduced a unique NcoI site at the start of translation, which was verified by DNA sequencing [33]. ... and Petunia FHT [9]. Catalytic activity The enzymatic activity of the recombinant protein was examined in FLS incubations employing dihydroquercetin or dihydrokaempferol as a subs...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: Increased expression of c-Fos by extracellular signal-regulated kinase activation under sustained oxidative stress elicits BimEL upregulation and hepatocyte apoptosis pot
... promoter activity induced by treatment with ATZ + mercaptosuccinic acid was largely attenuated by mutating the AP-1-binding site in the bim promoter region. Whereas the amounts of total and phosphory- lated ... factor deprivation, and insisted that the bim promoter acts as a coincidence detector [18]. Interestingly, mutation of the Myb-binding and FOXO-binding sites also slightly,...
Ngày tải lên: 06/03/2014, 00:21