báo cáo khoa học: "Upregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and increases proportion of Treg cells" pptx

... al.: Upregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and increases proportion of Treg cells. Journal of Experimental & ClinicalCancer ... Open AccessUpregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and increases proportion of Treg cells Jingyan Sun1†, Jinpu Yu2†, Hui Li2, ... recent hypothesis suggested that IDO may contribute to thedifferentiation of new T regulatory cells (Tregs) from naive CD4+ T cells. In this study we investigated the role of IDO in induction of...

báo cáo khoa học: "Lymphomatoid granulomatosis masquerading as interstitial pneumonia in a 66-year-old man: a case report and review of literature" pps

... interestsThe authors declare that they have no competing interests.Authors' contributionsAM was involved in conception and writing the manu-script. AM and KK participated in collection ... SparrowHealth System, and HTC and DT are also associate profes-sors at the Michigan State University.ConsentWritten informed consent was obtained from the patient'snext -of- kin for publication of ... Pulmonary and Critical Care fellow atWayne State University. DT is a hematology/oncologyprofessor at Michigan State University. WC and HTC arepathologists in the Department of Pathology at SparrowHealth...

Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt

... event and thusrepresents a fundamental difference in the reactionmechanism of this RNR and that of other class 1RNRs or, instead, is a result of the interaction of theR2F with the inactivated ... the putative ribosome bindingsite but not the promotor) was ampliﬁed by PCR usingprimers OB1 (5¢-TTT TTC TAG AGC AGG GTA GGTTGA TTT CAT GTC GAA TG-3¢; additional XbaI siteunderlined) and OB ... screening of phenotypes notdetectable in E. coli.It is essential to the ﬁeld of RNR research that thelong outstanding dispute over the metal content of theRNR of C. ammoniagenes is resolved. In the...

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

... CGCTCGAGATGAAAATTGACATCCATAGTCAT11rev AAAGCTGAGCTCCATTCAAATTGTTTTCTCTCAAG4fw TTCTCGAGATGGGAAAGTCTTCAGAGTGGTACMSD real-time PCR: primer and probe1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT2fw ATCCCAGGAAACACCAGTAGA10rev ... recon-stitute the activity by using the treatment that suc-cessfully restored the bacterial protein [21,33].Interestingly, the same difﬁculty in stripping off themetallocofactor from the protein has been ... 5¢-CGCTCGAGATGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCTATTCTACCAAAAGAATGGCC-3¢ and its complementfor His8Ala (substituted nucleotides are underlined)....

Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherﬁsh Misgurnus fossilis Functional consequences for the enzyme ppt

... composi-tion. The temperature acclimation pattern of proportional pooling of subunitswith different kinetic and thermodynamic properties of the tetrameric enzymemay result in ﬁne-tuning of the ... chan-ged by affecting rates of transcription and ⁄ or transla-tion and ⁄ or mRNA and protein degradation. Thisrepresents a quantitative strategy to offset the lack orexcess of kinetic energy (as ... very often leads to chan-ges in two main traits of some metabolic enzymes:quantitative and qualitative.The quantitative properties (concentration and, as aconsequence, total activity) of an...

Tài liệu Báo cáo khoa học: Altered expression of CD1d molecules and lipid accumulation in the human hepatoma cell line HepG2 after iron loading pptx

... family. In this context, it is import-ant to draw attention to the fact that HepG2 cells grown in iron rich media: (a) induced coordinatedchanges in the expression of the transferrin receptor and ... associated with growth retardationdue to a decrease in the percentage of cells in the cycle4with concomitant cell arrest in the G1 phase. Overall, and considering that in clinical situations of ... distilled water. Finally, sections werecounterstained in hematoxylin for 30 s and mounted in AQUATEXÒ(Merck, Darmstadt, Germany).Statistical analysesThe paired Student’s t- test (two-tailed)...

Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx

... by stimulation with serotonin,but is not direct evidence that Ras-GRF1 contributesto the serotonin-induced activation of Ras and ERK1 ⁄ 2. Pretreatment with H89 eliminated the sero-tonin-induced ... [32]. The sero-tonin-induced phosphorylation of Ras-GRF1-D1-225at Ser916 indicates that the protein is located in cellu-lar compartments within the reach of kinases activatedupon serotonin treatment. ... regulate its activity in coordinationwith increases in Ca2+, and so an effect from themutation of a single site may not be apparent. Theimportance of phosphorylation of Ras-GRF1 at thisresidue...

Tài liệu Báo cáo khoa học: Enhanced expression of Mcm proteins in cancer cells derived from uterine cervix docx

... Bluestaining.Table 2. Quantitation and comparison of proteins in GM and WI-38 cells. From the data in Fig. 2 and others, the concentrations of Mcmproteins, ORC2 and PCNA in total protein and ... probablyfunction in DNA replication, but the role of the proteins nottightly bound to chromatin remains to be determined.Consistent with the results at the protein level, semiquan-titative PCR and ... The intensity of the Mcm4band was clearly decreased at 22 h chase in both HeLa and WI-38 cells, indicating the presence of turnover of theprotein. Quantitation of the Mcm4 band suggested that...

Tài liệu Báo cáo khoa học: Functional expression and mutational analysis of ﬂavonol synthase from Citrus unshiu pptx

... Hybridiza-tion of the mismatch primer 5¢-CTCCACCTCCATGGATTTTATTTTCC-3¢ to the FLS 5¢ coding regionintroduced a unique NcoI site at the start of translation,which was veriﬁed by DNA sequencing [33]. ... and PetuniaFHT [9].Catalytic activityThe enzymatic activity of the recombinant protein wasexamined in FLS incubations employing dihydroquercetinor dihydrokaempferol as a substrate. Both these ... by alanine reduced the enzyme activity below 10% of control, while the substitution in Pro207ﬁGly did notaffect the FLS activity to a signiﬁcant extent (Table 2).Extraction of the mutants Gly68ﬁPro...

Báo cáo khoa học: Increased expression of c-Fos by extracellular signal-regulated kinase activation under sustained oxidative stress elicits BimEL upregulation and hepatocyte apoptosis pot

... promoter activity induced by treatment withATZ + mercaptosuccinic acid was largely attenuatedby mutating the AP-1-binding site in the bim promoterregion. Whereas the amounts of total and phosphory-lated ... factordeprivation, and insisted that the bim promoter acts asa coincidence detector [18]. Interestingly, mutation of the Myb-binding and FOXO-binding sites also slightly,but signiﬁcantly, reduced the ... reported that the inhibition of catalase and glutathione per-oxidase activities by treatment with 3-amino-1 ,2,4 -triazole (ATZ) and mer-captosuccinic acid evoked sustained increases in the levels...

Xem thêm