báo cáo khoa học: " RNAi-mediated knockdown of cyclooxygenase2 inhibits the growth, invasion and migration of SaOS2 human osteosarcoma cells: a case control study" ppt

báo cáo khoa học: " RNAi-mediated knockdown of cyclooxygenase2 inhibits the growth, invasion and migration of SaOS2 human osteosarcoma cells: a case control study" ppt

báo cáo khoa học: " RNAi-mediated knockdown of cyclooxygenase2 inhibits the growth, invasion and migration of SaOS2 human osteosarcoma cells: a case control study" ppt

... 5’TCGAGAAAAAAaaTCACATTTGATTGACAGTCCActcttgaTGG ACTGTCAATCAAATGTGATTA3’ LV- COX-2siRNA-3 Oligo1: 5’TaaCCTTCTCTAACCTCTCCTATTtcaagagAATAGGAGAGGTT AGAGAAGGTTTTTTTTC3’ Oligo2: 5’TCGAGAAAAAAaaCCTTCTCTAACCTCTCCTATTctcttgaAAT AGGAGAGGTTAGAGAAGGTTA3’ The ... 5’TaaACACAGTGCACTACATACTTAtcaagagTAAGTATGTAGTG CACTGTGTTTTTTTTTC3’ Oligo2: 5’TCGAGAAAAAAaaACACAGTGCACTACATACTTActcttgaTAA GTATGTAGTGCACTGTGTTTA...
Ngày tải lên : 10/08/2014, 10:21
  • 9
  • 373
  • 0
báo cáo khoa học: "Quantum dot-induced cell death involves Fas upregulation and lipid peroxidation in human neuroblastoma cells" pptx

báo cáo khoa học: "Quantum dot-induced cell death involves Fas upregulation and lipid peroxidation in human neuroblastoma cells" pptx

... (FADD) to the Death Domain in the cytoplasmic tail of the receptor, and can lead to caspase activation and cell death [22]. Down- stream signaling of Fas can also induce activation of lipases and ... which recruits caspase-8 or caspase-10, and forms the death- inducing signaling complex (DISC). Caspases-8/10 auto- catalyze their own cleavage [43-45], triggering a casca...
Ngày tải lên : 11/08/2014, 00:22
  • 13
  • 259
  • 0
Tài liệu Báo cáo khoa học: Hsp105b upregulates hsp70 gene expression through signal transducer and activator of transcription-3 pdf

Tài liệu Báo cáo khoa học: Hsp105b upregulates hsp70 gene expression through signal transducer and activator of transcription-3 pdf

... Stephanou A, Isenberg DA, Nakajima K & Latchman DS (1999) Signal transducer and activator of transcrip- tion-1 and heat shock factor-1 interact and activate the transcription of the Hsp-70 and ... TGGACGCGCGTAACCCGCAC Antisense GGGTTATGTTAGCTCAGTTACAGTA pGL70()298) Sense GCGCTGAAGCGCAGGCGGTCA Antisense GGGTTATGTTAGCTCAGTTACAGTA pGL70()218) Sense TGTCCCCTCCAGTGAATCCCAGA An...
Ngày tải lên : 18/02/2014, 06:20
  • 11
  • 584
  • 0
Báo cáo khoa học: Green fluorescent protein-tagging reduces the nucleocytoplasmic shuttling specifically of unphosphorylated STAT1 potx

Báo cáo khoa học: Green fluorescent protein-tagging reduces the nucleocytoplasmic shuttling specifically of unphosphorylated STAT1 potx

... [10,30]. The construct pSTAT1-NES-GFP was generated by PCR ampli- fication of pGST-NES-GFP using the primer pair 5¢-ATA TATGGATCCAGATAAAGATGTGAATGAG-3¢ and 5¢-CGCCCCGACACCCGCCAACACCC-3¢ and Vent DNA ... that an identical quantity of each activated STAT1 variant was incubated with the radioactive DNA probe. Shown is the autoradiogram of the native PAGE. (C) U 3A cells were...
Ngày tải lên : 30/03/2014, 09:20
  • 12
  • 248
  • 0
Báo cáo khoa học nông nghiệp " Reducing pesticide residues, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " docx

Báo cáo khoa học nông nghiệp " Reducing pesticide residues, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " docx

... of new varieties. Kohlrabi and Brassica vegetables are now planted with increasing percentage of new varieties (See Table 2 for more detail). The data shows that three years after the implantation ... implantation of the project, awareness of the farmers about use of new varieties have been improved, and many have used improved varieties. Seed sources and methods of...
Ngày tải lên : 21/06/2014, 04:20
  • 13
  • 587
  • 0
Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " First Six-Monthly Report docx

Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " First Six-Monthly Report docx

... aspects of the GAP manual and particularly the quality assurance aspects based on the NSW Department of Primary Industries FreshCare ® program. iii. Watermelon varieties planted and harvested ... demonstration variety and GAP trials which will be the basis of farmer field days, postharvest research investigating temperature management and packaging along the sup...
Ngày tải lên : 21/06/2014, 04:20
  • 10
  • 507
  • 0
Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS6 pdf

Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS6 pdf

... temperature management and packaging along the supply chain, intensive training of Vietnamese horticulturalists in Australia and the delivery of a large workshop at the end of the project to ensure the ... several training initiatives. Such as the establishment of demonstration variety and GAP trials which are the basis of farmer field days, postharvest res...
Ngày tải lên : 21/06/2014, 04:20
  • 8
  • 478
  • 0
Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS7 ppt

Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS7 ppt

... Australian Organisation Applied Horticultural Research Pty. Ltd.(AHR) ACN 073 642 510; Suite 352 Biomedical Building 1 Central Ave, Everleigh NSW 2015 Australia Australian Personnel Prof. ... 352, Biomedical Building, 1 Central Avenue, Australian Technology Park, Eveleigh N.S.W. 2015 Australia Email: gordon@ahr.com.au In Australia: Administrative contact Name: Lynn Christie...
Ngày tải lên : 21/06/2014, 04:20
  • 4
  • 467
  • 0
Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS8 doc

Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS8 doc

... horticulturalists in Australia and the delivery of a large workshop at the end of the project to ensure the information is available to as wide an audience as possible. Another important aim is ... and GAP trials which will be the basis of farmer field days, postharvest research investigating temperature management and packaging along the supply chain, intensi...
Ngày tải lên : 21/06/2014, 04:20
  • 8
  • 380
  • 0
Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS10 pdf

Báo cáo khoa học nông nghiệp " Reducing pesticide resides, improving yield, quality and marketing of vegetables crops in Northern Central Vietnam through improved varieties, GAP principles and farmer focused training " MS10 pdf

... pre- and post training analysis) of change in awareness and competency levels of research and extension workers, farmers and private sector input suppliers and marketers) in 1. Potential and ... post harvest handling and IPM (problem identification and management options) There has been a significant investment of project time in the development and implem...
Ngày tải lên : 21/06/2014, 04:20
  • 11
  • 389
  • 0