Báo cáo y học: "Perceptions of environmental changes and Lethargic Crab Disease among crab harvesters in a Brazilian coastal community" ppt

... will be made available soon. Perceptions of environmental changes and Lethargic Crab Disease among crab harvesters in a Brazilian coastal community Journal of Ethnobiology and Ethnomedicine 2011, ... estuary mangrove forests was undertaken using aerial photographs and maps instead of illustrations and drawings made by the crab harvesters. This mapping...

Ngày tải lên: 10/08/2014, 09:22

... that cyclosporin A (CsA), vinblastine, and valinomycin (and several other drugs; N. Nagy, K. Goda, F. Fenyvesi & G. Szabo ´ Jr, unpublished data) 1 interactwithPgpinsuchamannerthat preincubation ... Walker, J.E., Saraste, M., Runswick, M.J. & Gay, N.J. (1982) Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP requiri...

Ngày tải lên: 08/03/2014, 23:20

... Portugal. Authors’ contributions EC analyzed and interpreted the data regarding the neurological presentation of the disease, and was the major contributor in writing the manuscript. AMS analyzed and ... was obtained from the patient for publication of this case report and any accompany- ing images. A copy of the written consent is available for review by the Editor -in- Ch...

Ngày tải lên: 11/08/2014, 00:22

... wishes, haemodialysis was discontinued. Creatinine level at this point was 650 μmol/litre. At 1 year after discontinuation of dialysis, the patient remains symptomatically well and the myeloma is in remission. ... complaining of feeling tired and weak. She had previously been fit and well, and did not take any medications. Initial investigations revealed that she was in acute...

Ngày tải lên: 11/08/2014, 19:21

... performed laboratory assays, SJ participated in the coordination of the study. BP and BJ participated in the diagnostic evaluation of the patients, MM and MK contributed the data-analysis, interpretation ... data-analysis, interpretation of the data and drafting of the manuscript, GS initiated and coordinated the study. All authors read and approved the final manuscript....

Ngày tải lên: 11/08/2014, 16:22

... perceptions of vaginal microbicides as a potential HIV prevention method among health care providers in Durban and Hlabisa, South Africa, using a combination of quantitative and qualitative methods. Results: ... preg- nancy in South Africa. African J Rep Health 2003, 7:13-19. 6. Fairhurst K, Ziebland S, Wyke S, Seaman P, Glasier A: Emergency contraception: why can't yo...

Ngày tải lên: 10/08/2014, 05:20

... predictably affect the loop conformation and causes pro - blems of escape mutants and diagnostic failure. As of the property of each amino acid, protein is a macromolecule made of monomeric amino acids. ... side-chains. T12 3A mutant, on the other hand, involved changes from a polar Thr into a non-polar and slightly smaller Ala. Although it may affect the confor- mation...

Ngày tải lên: 12/08/2014, 02:20

... potenti- ating gas trapping. In the presence of disease, and particu- larly in CF, impaired airway clearance mechanisms and inflammatory changes associated with chronic infection disrupt small airway ... according to group using linear mixed-effect model analysis. (PA: chronically infected by P. aeruginosa; PA_comb: chronically infected by P. aeruginosa and other bacteria; SA:...

Ngày tải lên: 12/08/2014, 16:20

... inability to achieve optimal dosing. Approximately 30% of patients will discontinue therapy. Often the only way of maintaining Int. J. Med. Sci. 2006, 3 79 International Journal of Medical ... hepatitis B post- transplant. Characteristically, there is a very high HCV serum RNA level, profound hyperbilirubinemia and high levels of alkaline phosphatase and gamma-glutamyl tr...

Ngày tải lên: 31/10/2012, 17:08

... ABP130-5¢(CTCGAGGGTGTTATAATGG ATCGAGGTGGACGAGT)/ABP130-3¢ (CTC GAG ATTCAATTATTTAGTACAAATGGCTAAGAGG CATTT); (2) ABP96: ABP130-5¢/ABP96-3¢ (CTCGAGAGGCAAC AACAGACGATGAGGCAACTTA); (3) ABP64: ABP130-5¢/ABP64-3¢(CTCGAGACCAGA GATCTCATCATTATCATTGTAATT). XhoI ... (twice) as baits. We also examined the ability of AFP to interact with ABP130, ABP96, and ABP64 in the two-hybrid assay. We found a...

Ngày tải lên: 08/03/2014, 22:20