Báo cáo y học: "Extra corporal membrane oxygenation in general thoracic surgery: a new single veno-venous cannulatio" potx

Báo cáo y học: "Extra corporal membrane oxygenation in general thoracic surgery: a new single veno-venous cannulatio" potx

Báo cáo y học: "Extra corporal membrane oxygenation in general thoracic surgery: a new single veno-venous cannulatio" potx

... this article as: Souilamas et al.: Extra corporal membrane oxygenation in general thoracic surgery: a new single veno-venous cannulation. Journal of Cardiothoracic Surgery 2011 6:52. Submit your ... Extracorporeal oxygenation support for curative surgery in a patient with papillary thyroid carcinoma invading the trachea. J Laryngol Otol 2009, 123(7):807-10. 5. Jie...
Ngày tải lên : 10/08/2014, 09:21
  • 3
  • 301
  • 0
 Báo cáo y học: " Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphis"

Báo cáo y học: " Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphis"

... 2001;413(6853):316-22. 4. Yada M, Hatakeyama S, Kamura T, Nishiyama M, Tsunematsu R, Imaki H, Ishida N, Okumura F, Nakayama K, Nakayama KI. Phosphorylation-dependent degradation of c-Myc is mediated by the F-box ... Tsunematsu R, Nakayama K, Oike Y, Nishiyama M, Ishida N, Hatakeyama S, Bessho Y, Kageyama R, Suda T, Nakayama KI. Mouse Fbw7/Sel-10/Cdc4 is required for notch degradation...
Ngày tải lên : 31/10/2012, 16:49
  • 4
  • 393
  • 0
Báo cáo y học: " Prolonged extracorporeal membrane oxygenation therapy for severe acute respiratory distress syndrome in a child affected by rituximab-resistant autoimmune hemolytic anemia: a case report" pptx

Báo cáo y học: " Prolonged extracorporeal membrane oxygenation therapy for severe acute respiratory distress syndrome in a child affected by rituximab-resistant autoimmune hemolytic anemia: a case report" pptx

... in Cases Database Any patient, any case, can teach us something www.casesnetwork.com Case report Open Access Prolonged extracorporeal membrane oxygenation therapy for severe acute respiratory distress ... methylprednisolone at 2mg/kg/day was administered for 5 days (Figure 1). An adequate Hb increase was obtained and the child was discharged after 10 days with oral prednisone at 2mg/kg/...
Ngày tải lên : 11/08/2014, 17:21
  • 5
  • 311
  • 0
Báo cáo Y học: Molecular cloning and characterization of isomultiflorenol synthase, a new triterpene synthase from Luffa cylindrica, involved in biosynthesis of bryonolic acid ppt

Báo cáo Y học: Molecular cloning and characterization of isomultiflorenol synthase, a new triterpene synthase from Luffa cylindrica, involved in biosynthesis of bryonolic acid ppt

... glabra GgbAS1 b-amyrin synthase [6], was prepared by PCR using GgbAS1 as a template, Taq DNA polymerase (Takara Shuzo, Kyoto, Japan), the primers 5 0 -GAAGCATA TCCACTATGAAGATGA-3 0 and 5 0 -TGAATACTCCCGTG ATTTCCTGTTG-3 0 , ... Kenichiro Inoue 1 , Noboru Hiraoka 2 , Yasumasa Ikeshiro 2 , Kazufumi Yazaki 3 , Shigeo Tanaka 4 , Tetsuo Kushiro 5 , Masaaki Shibuya 5 and Yutaka Ebizuka 5 1 Gifu Ph...
Ngày tải lên : 08/03/2014, 23:20
  • 7
  • 491
  • 1
Báo cáo Y học: Structural and compositional changes in very low density lipoprotein triacylglycerols during basal lipolysis potx

Báo cáo Y học: Structural and compositional changes in very low density lipoprotein triacylglycerols during basal lipolysis potx

... chylomicrons containing more saturated fatty acids [34]. In the present study, triacylglycerol species containing highly unsaturated fatty acids were also differ- entially affected by lipolysis. ... these fatty acids. It has been shown that the hydrolysis of 20:4 containing triacylglycerol and diacylglycerol was slower in rat postheparin plasma when hepatic lipase was inhibited [36]. Hepa...
Ngày tải lên : 23/03/2014, 21:20
  • 10
  • 412
  • 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

... 5¢-CCGTT TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢. C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢.C-213S:5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢. C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢. ... H24 4A: 5¢-CAAAGAAGCAGATCATAT GGGAATGCTTTCGCAGCCAAGGG-3¢. D21 6A: 5¢-G CGAGCTTATATCTTTTGCAATGAAGATAAATCAT TTCCAGTTGAG-3¢ All of the primers were 5¢-phosphorylate...
Ngày tải lên : 24/03/2014, 04:21
  • 8
  • 345
  • 0
Báo cáo y học: "ECT associated musical hallucinations in an elderly patient: a case report" pps

Báo cáo y học: "ECT associated musical hallucinations in an elderly patient: a case report" pps

... hallu- cinations [2,3]. Musical hallucinations are pseudo hallucinations that originate in memory representations and they may undergo a transition to true hallucination. In musical hal- lucination ... report Raguraman Janakiraman* 1 , Keith Wildgoose 2 and Kalyan Seelam 1 Address: 1 Department of Psychiatry, Sheffield Care Trust, S5 7JT, UK and 2 Department of Psychiatry, Doncaster...
Ngày tải lên : 08/08/2014, 21:20
  • 3
  • 340
  • 0
Báo cáo y học: "Genome-wide association studies in systemic lupus erythematosus: a perspective" docx

Báo cáo y học: "Genome-wide association studies in systemic lupus erythematosus: a perspective" docx

... Chung SA, Ferreira RC, Pant PV, Ballinger DG, Kosoy R, Demirci FY, Kamboh MI, Kao AH, Tian C, Gunnarsson I, Bengtsson AA, Rantapaa-Dahlqvist S, Petri M, Manzi S, Seldin MF, Ronnblom L, Syvanen AC, ... for a much larger additional GWAS, in both Europeans and non-Europeans, with clearly defined clinical criteria and at a much greater density of markers. This scale of experiment, which is...
Ngày tải lên : 09/08/2014, 14:22
  • 2
  • 222
  • 0
Báo cáo y học: " Physiotherapy-supervised mobilization and exercise following cardiac surgery: a national questionnaire survey in Sweden" pot

Báo cáo y học: " Physiotherapy-supervised mobilization and exercise following cardiac surgery: a national questionnaire survey in Sweden" pot

... period in h ospital [4-7]. Physiotherapy management of patients undergoing cor- onary artery bypass graft (CABG) surgery [ 8] and thor- acic surgery [9] has been examined in Australia and New Zealand. ... 102:1609-1616. 15. Hallberg V, Kataja M, Tarkka M, Palomaki A: Retention of work capacity after coronary artery bypass grafting. A 10-year follow-up study. J Cardiothorac Surg 2009,...
Ngày tải lên : 10/08/2014, 09:22
  • 7
  • 437
  • 0
Báo cáo y học: "Pharmacologic prophylaxis for atrial fibrillation following cardiac surgery: a systematic revie" pps

Báo cáo y học: "Pharmacologic prophylaxis for atrial fibrillation following cardiac surgery: a systematic revie" pps

... Yazigi A, Haddad F, Hayeck G, Rassi IE, Ashoush R, Jebara V: Postoperative oral amiodarone versus oral bisoprolol as prophylaxis against atrial fibrillation after coronary artery bypass graft surgery: ... Koyanagi T, Kasegawa H, Miyazaki M: Three-Day magnesium administration prevents atrial fibrillation after coronary artery bypass grafting. Ann Thorac Surg 2005, 79:117-26. 69. Kaplan M, K...
Ngày tải lên : 10/08/2014, 09:23
  • 10
  • 441
  • 0

Xem thêm