Enterovirus type 71 2A protease functions as a transcriptional activator in yeast ppsx

... (5’-CATAATGACTGGGCAAACTCATCTACCACTGCTCAA-3’) L30/43 -AS (5’-TTGAGCAGTGGTAGATGAGTTTGCCCAGTCATTATG-3’) 2AY -AS1 01 (5’-CCGCTCGAGTTACTGATCATCCAACCACAGAAG-3’) 2A- AS3 01 (5’-GCTCTAGACTGATCATCCAACCACAGAAG-3’) CoxB2AY-S ... (5’-TTATTAATAATACTCGCTGGCCTC-3’) 2AY-11 0AS (5’-TTATTAGCAATCCCCTGGTTCCGA-3’) 2AY-13 0AS (5’-TTATTAGCAATCCCCTGGTTCCGA-3’) VP1 / 2A- S (5’-CCATCGATATGATGGGTACGTTC-3’) 2A...

Ngày tải lên: 10/08/2014, 05:21

... helicase A interacts with nuclear factor jB p65 and functions as a transcriptional coactivator Toshifumi Tetsuka 1 , Hiroaki Uranishi 1 , Takaomi Sanda 1 , Kaori Asamitsu 1 , Jiang-Ping Yang 2 , Flossie ... of California San Diego, La Jolla, CA, USA RNA helicase A (RHA), a member of DNA and RNA helicase f amily containing ATPase activity, is involved in many steps of gene expr...

Ngày tải lên: 30/03/2014, 15:20

... actin, protein kinase N, casein-kinase-2-like serine kinase and amphiphysin, Keywords hydrogen peroxide; peroxiredoxin II; phosphatidic acid; phospholipase D1; PMA Correspondence M. Frohman, ... physiological rather than an artifact of lysis. These results also support, using a visual rather than molecular biochemical approach, the proposal that PMA triggers increased interaction between PL...

Ngày tải lên: 20/02/2014, 01:20

... 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ (siNup- 358-2)]. ... 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS. The oligonucleotide fragment for NES-NLS was flan...

Ngày tải lên: 06/03/2014, 01:20

... necessary to view motivation as one of a number of variables in an intricate model of interrelated individual and situational factors which are unique to each language learner. Motivation in ... language and then output, expressed as linguistic performance when investigating language learning. In order to examine language learning in the Japanese context it is necessary to e...

Ngày tải lên: 06/09/2013, 10:10

... languages is that of setting up comparable units of analysis within the various languages being studied. Thomas, J. (1995), “Meaning in interaction: An introduction to Pragmatics, Longman.” ... English as a foreign language, the Vietnamese learners of English usually apply what they have accumulated from the various textbooks. As a result, in some cases, they might know a...

Ngày tải lên: 26/11/2013, 13:31

... forces. One of the troops killed was a U.S. Marine in Iraq's expansive Al Anbar province a spokesman for the multinational force said; the dead soldier's nationality was not disclosed. (CNN, ... example: ‘Put that gun down,’ said one of the lawyers at the table. His name was Rafter. He was a hard man in a courtroom, maybe the hardest lawyer that Drake & Sweeney had....

Ngày tải lên: 21/12/2013, 13:00

... important to be bilingual? 9 Maintaining the first language in children under three 10 Maintaining the first language in years prior in children age three to six years 11 Learning English as a second ... English as a second language and Multicultural Education Interpreting and translating services Resources Available 17 Supporting Children Learning English as a Second Language...

Ngày tải lên: 24/02/2014, 18:20

... DG H 2 O D -values (conformational stability in absence of denaturant) was then calculated. [ 3 H]-cGMP binding assay To assay the capability of PKG wild -type to bind cGMP at different urea concentrations, ... subsequently assayed for radioactivity in a scintillation counter. A negative control was performed using a protein free sample. A. Scholten et al. PKG’s hinge region acts...

Ngày tải lên: 07/03/2014, 09:20

... carcinomas in dogs have similarities of prevalence, metastasis and disease pattern compared with the breast cancer in human [27]. In humans, p53 gene mutations have been documented in breast cancer ... study, a total of 20 cases were examined, among which there were 5 malignant mixed tumors, 4 mammary gland adenocarcinomas, 1 papillary adenocarcinoma, 8 benign mixed tumors and 2 m...

Ngày tải lên: 07/08/2014, 17:22