Báo cáo y học: " The Iranian female high school students'''''''' attitude towards people with HIV/AIDS: a cross-sectional study" pot
Báo cáo y học: " The Iranian female high school students'''' attitude towards people with HIV/AIDS: a cross-sectional study" pot
... Central
Page 1 of 5
(page number not for citation purposes)
AIDS Research and Therapy
Open Access
Research
The Iranian female high school students' attitude towards people
with HIV/AIDS: a cross-sectional ... Sciences, Daneshgah St., Tabriz, Iran
Email: Kamyar Ghabili* - kghabili@gmail.com; Mohammadali M Shoja - shoja.m@gmail.com; Pooya Kamran - pooya_kamran@yahoo...
Báo cáo y học: "The Systemic Inflammatory Response Syndrome (SIRS) in acutely hospitalised medical patients: a cohort study"
... symptoms
including fever or hypothermia, tachycardia, tachypnoea and change in blood leucocyte count. The
relationship between SIRS symptoms and morbidity and mortality in medical emergency ward
patients is unknown.
Methods: ... first
draft. MS and AL contributed to the design of the study
and the interpretation of the data and made a critical revi-
sion of the manuscript. All a...
Báo cáo y học: "The paediatric flat foot proforma (p-FFP): improved and abridged following a reproducibility study" pptx
... interests.
Authors' contributions
AE conceived and lead the study, participated in data col-
lection, performed the statistical analysis and drafted the
manuscript. HN and NZ participated in data ... common age of presentation, parental
concern and clinical quandary regarding management
[36].
The paediatric flat foot proforma (p-FFP) provides a prag-
matic standard by which pae...
Báo cáo y học: "Familial, structural, and environmental correlates of MRI-defined bone marrow lesions: a sibpair study" pot
... met in the centre of the tibial
spines was measured by a protractor (Protractor Stirflex Pro;
ORNA IPLAST S.p .A. , Cavaion, Verona, Italy) manually on the
X-ray. The measurement was done by a single ... follows: grade 0 = normal cartilage;
grade 1 = focal blistering and intracartilaginous low-signal
intensity area with an intact surface; grade 2 = irregularities on
the surfac...
báo cáo khoa học: "Increasing delivery of an outdoor journey intervention to people with stroke: A feasibility study involving five community rehabilitation teams" pps
... Research
(NaCCOR), Nursing and Midwifery, The Australian Catholic University,
Australia.
Authors’ contributions
The first author conceptualised and planned the study, collected and
analysed the data, and ... delivery (out-patient, domi-
ciliary, and day hospital). To be eligible, teams had to
employ at least one occupational therapist and one phy-
siotherapist, and ha ve seen at least...
Báo cáo y học: "The effect of high correlated colour temperature office lighting on employee wellbeing and work performance" ppt
... m. Each work area has dark floors
and white walls. Floors have windows on approximately
80% of both their East and West wall areas. Blinds are
present and used in such a way that typically more ... 45 and a minimum of 9. All
data collection and storage was compliant with the UK
Data Protection Act 1998.
All items from the modified Columbia Jet Lag Scale were
utilised in the analys...
Báo cáo Y học: The Saccharomyces cerevisiae type 2A protein phosphatase Pph22p is biochemically different from mammalian PP2A potx
... (Pph22p
without first 77 amino acids) and the N-terminus of Pph22p
(only the first 77 amino acids) we used: sense primer:
5¢-CG
GGATCCACCATGCATCATCATCATCATCAT
CATCATCTTGACCAATGGATTGAGCATTTG-3¢
(BamHI ... purification (protein
precipitation with ammonium sulfate, ion-exchange chromatography
on DEAE-Sephacel and a nity chromatography on Ni
2+
-nitrilotri-
acetatic acid agarose were taken an...
Báo cáo Y học: The refolding of type II shikimate kinase from Erwinia chrysanthemi after denaturation in urea pot
... of
the strands 23145 in the parallel b sheet places the enzyme in
thesamestructuralfamilyastheNMPkinases(adenylate
kinase, guanylate kinase, uridylate kinase and thymidine
kinase).
SK has a number ... J.R. &
Lapthorn, A. J. (1997) Crystallisation and preliminary X-ray
crystallographic analysis of shikimate kinase from Erwinia
chrysanthemi. Acta Crystallogr. D53, 612–614.
20. Gill...
Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx
... compared to the wild-
type enzyme.
Enzyme assays
Wild-type DAOCS and all mutants were assayed for their
ability to convert 2-oxoglutarate to succinate and carbon
dioxide [17], and penicillin N and ... of the catalytic mechanism of
DAOCS [8–10] has been significantly advanced by the
determination of the crystal structure of wild-type and
mutant DAOCS with various ligands [1,11–13]. Ho...
Báo cáo Y học: The C-terminal region of ammodytoxins is important but not sufficient for neurotoxicity pot
... oligonucleotide
5¢-ca
gga tcc atc gaa ggt cGG AAC CTT TAC CAG TTC
GGG-3¢ and the antisense oligonucleotide 5¢-cg taa aa
ctgc
agt tcg AAA GCA GAT TGC CGC GAC CC-3¢ (sequences
complementary to the template are ... interfacial
enzymes that access the substrate directly from the phos-
pholipid–water interface. In addition to enzymatic activity,
those that are found in animal venoms may al...