... Central Page 1 of 5 (page number not for citation purposes) AIDS Research and Therapy Open Access Research The Iranian female high school students' attitude towards people with HIV/AIDS: a cross-sectional ... Sciences, Daneshgah St., Tabriz, Iran Email: Kamyar Ghabili* - kghabili@gmail.com; Mohammadali M Shoja - shoja.m@gmail.com; Pooya Kamran - pooya_kamran@yahoo...
Ngày tải lên: 10/08/2014, 05:21
... symptoms including fever or hypothermia, tachycardia, tachypnoea and change in blood leucocyte count. The relationship between SIRS symptoms and morbidity and mortality in medical emergency ward patients is unknown. Methods: ... first draft. MS and AL contributed to the design of the study and the interpretation of the data and made a critical revi- sion of the manuscript. All a...
Ngày tải lên: 25/10/2012, 09:56
Báo cáo y học: "The paediatric flat foot proforma (p-FFP): improved and abridged following a reproducibility study" pptx
... interests. Authors' contributions AE conceived and lead the study, participated in data col- lection, performed the statistical analysis and drafted the manuscript. HN and NZ participated in data ... common age of presentation, parental concern and clinical quandary regarding management [36]. The paediatric flat foot proforma (p-FFP) provides a prag- matic standard by which pae...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo y học: "Familial, structural, and environmental correlates of MRI-defined bone marrow lesions: a sibpair study" pot
... met in the centre of the tibial spines was measured by a protractor (Protractor Stirflex Pro; ORNA IPLAST S.p .A. , Cavaion, Verona, Italy) manually on the X-ray. The measurement was done by a single ... follows: grade 0 = normal cartilage; grade 1 = focal blistering and intracartilaginous low-signal intensity area with an intact surface; grade 2 = irregularities on the surfac...
Ngày tải lên: 09/08/2014, 08:22
báo cáo khoa học: "Increasing delivery of an outdoor journey intervention to people with stroke: A feasibility study involving five community rehabilitation teams" pps
... Research (NaCCOR), Nursing and Midwifery, The Australian Catholic University, Australia. Authors’ contributions The first author conceptualised and planned the study, collected and analysed the data, and ... delivery (out-patient, domi- ciliary, and day hospital). To be eligible, teams had to employ at least one occupational therapist and one phy- siotherapist, and ha ve seen at least...
Ngày tải lên: 10/08/2014, 10:23
Báo cáo y học: "The effect of high correlated colour temperature office lighting on employee wellbeing and work performance" ppt
... m. Each work area has dark floors and white walls. Floors have windows on approximately 80% of both their East and West wall areas. Blinds are present and used in such a way that typically more ... 45 and a minimum of 9. All data collection and storage was compliant with the UK Data Protection Act 1998. All items from the modified Columbia Jet Lag Scale were utilised in the analys...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo Y học: The Saccharomyces cerevisiae type 2A protein phosphatase Pph22p is biochemically different from mammalian PP2A potx
... (Pph22p without first 77 amino acids) and the N-terminus of Pph22p (only the first 77 amino acids) we used: sense primer: 5¢-CG GGATCCACCATGCATCATCATCATCATCAT CATCATCTTGACCAATGGATTGAGCATTTG-3¢ (BamHI ... purification (protein precipitation with ammonium sulfate, ion-exchange chromatography on DEAE-Sephacel and a nity chromatography on Ni 2+ -nitrilotri- acetatic acid agarose were taken an...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo Y học: The refolding of type II shikimate kinase from Erwinia chrysanthemi after denaturation in urea pot
... of the strands 23145 in the parallel b sheet places the enzyme in thesamestructuralfamilyastheNMPkinases(adenylate kinase, guanylate kinase, uridylate kinase and thymidine kinase). SK has a number ... J.R. & Lapthorn, A. J. (1997) Crystallisation and preliminary X-ray crystallographic analysis of shikimate kinase from Erwinia chrysanthemi. Acta Crystallogr. D53, 612–614. 20. Gill...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx
... compared to the wild- type enzyme. Enzyme assays Wild-type DAOCS and all mutants were assayed for their ability to convert 2-oxoglutarate to succinate and carbon dioxide [17], and penicillin N and ... of the catalytic mechanism of DAOCS [8–10] has been significantly advanced by the determination of the crystal structure of wild-type and mutant DAOCS with various ligands [1,11–13]. Ho...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo Y học: The C-terminal region of ammodytoxins is important but not sufficient for neurotoxicity pot
... oligonucleotide 5¢-ca gga tcc atc gaa ggt cGG AAC CTT TAC CAG TTC GGG-3¢ and the antisense oligonucleotide 5¢-cg taa aa ctgc agt tcg AAA GCA GAT TGC CGC GAC CC-3¢ (sequences complementary to the template are ... interfacial enzymes that access the substrate directly from the phos- pholipid–water interface. In addition to enzymatic activity, those that are found in animal venoms may al...
Ngày tải lên: 31/03/2014, 08:20