Báo cáo y học: " SpeCond: a method to detect condition-specific gene expressio" doc

Báo cáo y học: "An innovative method to evaluate the suture compliance in sealing the surgical wound lip"

Báo cáo y học: "An innovative method to evaluate the suture compliance in sealing the surgical wound lip"

... monofilament 50% at 14 days 105 days good Obstetrics- gynecology, urology, plastic, abdominal, and vascular POLYDIOXANONE: ester polymer monofilament 70% at 14 days 200 days poor Abdominal, thoracic, ... coated by polyglactin 370 and Ca ++ stearate braided 45% at 7 days 50 days good Subcutaneous and cutaneous clo- sure, pediatric, and obstet- rics-gynecology VICRYL COATED: glycol and l...

Ngày tải lên: 03/11/2012, 11:52

7 603 0
Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

... forward primer D11–13 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢)and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; ... D11-13 mutant; forward primer F1 (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse pri- mer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to generate the...

Ngày tải lên: 18/03/2014, 01:20

8 1,1K 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

... arrow). Y5 1 AMY2 and Y8 2 TAA are in orange. Other binding residues (W9 AMY2 , H92 AMY2 , T94 AMY2 , A9 5 AMY2 , Y1 30 AMY2 , A1 45 AMY2 , F180 AMY2 , K182 AMY2 , W206 AMY2 , S208 AMY2 , Y2 11 AMY2 , ... TAA (in black). The superimpositioning was guided by the catalytic acids (D179 AMY2 , E204 AMY2 , and D289 AMY2 and D206 TAA , E230 TAA , and D297 TAA ). The invariant Y5 1 AMY2 and...

Ngày tải lên: 31/03/2014, 08:20

14 557 0
Báo cáo y học: "Mactinin: a modulator of the monocyte response to inflammation" pps

Báo cáo y học: "Mactinin: a modulator of the monocyte response to inflammation" pps

... http://arthritis-research.com/content/5/6/R310 R315 20. Fujikawa Y, Sabokbar A, Neale S, Athanasou NA: Human osteo- clast formation and bone resorption by monocytes and syn- ovial macrophages in rheumatoid arthritis. Ann Rheum Dis 1996, ... thawed, dialyzed against phosphate- buffered saline, and centrifuged again; the total sample volume was then applied to a column of immunoaffinity-...

Ngày tải lên: 09/08/2014, 01:23

7 388 0
Báo cáo y học: "DAS28: a useful instrument to monitor infliximab treatment in patients with rheumatoid arthritis" pps

Báo cáo y học: "DAS28: a useful instrument to monitor infliximab treatment in patients with rheumatoid arthritis" pps

... disease activity to study the validity of the Disease Activity Score and the DAS28. In a study performed in Italy in the late 1990s, it was found that the Disease Activity Score was the best measure to ... daily clinical practice and clinical trials. Conclusion The study of Vander Cruyssen and colleagues confirms that the DAS28 is a valid measure to monitor disease activity and to...

Ngày tải lên: 09/08/2014, 07:20

2 371 0
Báo cáo y học: "Reproducibility and sensitivity to change of various methods to measure joint space width in osteoarthritis of the hip: a double reading of three different radiographic views taken with a three-year interval" pot

Báo cáo y học: "Reproducibility and sensitivity to change of various methods to measure joint space width in osteoarthritis of the hip: a double reading of three different radiographic views taken with a three-year interval" pot

... Pitié-Salpétrière Hospital. Included were outpatient with symptomatic hip OA (according to the American College of Rheumatology criteria [20]), who were 45–75 years old and who had a manually measured JSW on plain AP ... intraclass coefficient (ICC) and Bland–Altman method for readers 1 and 2 and their mean. Sensitivity to change was estimated using the standardized response mean (SRM...

Ngày tải lên: 09/08/2014, 07:20

11 411 0
Báo cáo y học: "Failure of catecholamines to shift T-cell cytokine responses toward a Th2 profile in patients with rheumatoid arthritis" pdf

Báo cáo y học: "Failure of catecholamines to shift T-cell cytokine responses toward a Th2 profile in patients with rheumatoid arthritis" pdf

... cancer). Patients were examined by taking history, physical examina- tion, and laboratory findings (erythrocyte sedimentation rate, C-reactive protein [CRP], rheumatoid factor, anti-nuclear anti- bodies, ... rheumatoid arthritis. J Rheumatol 2003, 30:1928-1934. 5. van Roon JA, van Roy JL, Duits A, Lafeber FP, Bijlsma JW: Proin- flammatory cytokine production and cartilage damage due to rhe...

Ngày tải lên: 09/08/2014, 08:22

11 363 0
Báo cáo y học: "Determining a low disease activity threshold for decision to maintain disease-modifying antirheumatic drug treatment unchanged in rheumatoid arthritis patients" docx

Báo cáo y học: "Determining a low disease activity threshold for decision to maintain disease-modifying antirheumatic drug treatment unchanged in rheumatoid arthritis patients" docx

... They were on aver- age 43 ± 6.6 years old, 38% were female, and they obtained their certification as rheumatologists on average 17 ± 6.3 years ago. The panelists' clinical activity was university ... Intensive treatment with meth- otrexate in early rheumatoid arthritis: aiming for remission. Computer Assisted Management in Early Rheumatoid Arthritis (CAMERA, an open-label strategy trial)...

Ngày tải lên: 09/08/2014, 14:22

8 354 0
Báo cáo y học: "Assisted assembly: how to improve a de novo genome assembly by using related species" pptx

Báo cáo y học: "Assisted assembly: how to improve a de novo genome assembly by using related species" pptx

... from Mammal24 - 2× assemblies Otolemur garnetti (bushbaby) Loxodonta africana (African elephant) Oryctolagus cuniculus (rabbit) Cavia porcellus (guinea pig) Initial Assisted* Initial Assisted* ... high-coverage data set (C. familiaris), so that we can rigorously assess the effect of assistance on assembly accuracy, continuity and completeness. We then apply the method to several low-c...

Ngày tải lên: 09/08/2014, 20:20

9 338 0
Từ khóa:
w