Báo cáo y học: "SHROOM3 is a novel candidate for heterotaxy identified by whole exome sequencing" pptx
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Acad Sci USA 2006; 103(39): 14584-14589. 16. Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N. Peptidomic ... ELISA assays (see Materials and Methods for more information). Decreased Vgf content In CSF and serum precedes onset of ALS-type muscle weakness assessed by rotarod-assays. In...
Ngày tải lên: 03/11/2012, 10:52
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... evalu- ated by the chi-square test for categorical variables. Comparison of group differences for continuous variables was carried out by one-way analysis of variance or the Kruskal-Wal- lis ... 51:189-197. 27. A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Vali- dation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients. Anesth A...
Ngày tải lên: 25/10/2012, 10:35
Tài liệu Báo cáo Y học: Characterization of a novel silkworm (Bombyx mori ) phenol UDP-glucosyltransferase potx
... Science, Technology and Medicine, London SW7 2AZ, UK; 2 Laboratory of Molecular Entomology and Baculovirology, Riken, Wako, Japan Sugar conjugation is a major pathway for the inactivation and excretion ... haemocytes) was isolated by the guanidinium thiocyanate method [17]. Integument samples may have contained small amounts of muscle and tracheal tissue also. Bmugt1 expression was s...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... disRAS1fwd 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 was constructed to contain SUT2 as ... 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA CATGCATGAAACCTACAGCTGAAGCTTCGT...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt
... such as bundles and cables, is crucial to stabilize the organiza- tion of transvacuolar strands and maintain overall cellular architecture. As mentioned above, CRP1 may participate in the formation ... pellets (P) and supernatants (S) were analyzed by SDS ⁄ PAGE and stained with Coomassie Brilliant Blue. (C) Quantitation analysis for GST–hhLIM association with F-actin at different conce...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo y học: "T-614, a novel immunomodulator, attenuates joint inflammation and articular damage in collagen-induced arthritis" docx
... 5'-ACCAGAGGCATAC AGGGACAA-3' IFN-γ 5'-GAAAGACAACCAGGCCATCAG-3' 5'-TCATGAATGCATCCTTTTTTGC-3' IL-4 5'-CCACGGAGAACGAG CTCATC-3' 5'-GAGAACCCCAGACTTGTTCTTCA-3' IL-17 ... Tamura T, Udagawa N, Takahashi N, Miyaura C, Tanaka S, Yamada Y, Koishihara Y, Ohsugi Y, Kumaki K, Taga T, Kishimoto T, Suda T: Soluble interleukin-6 receptor triggers osteoclas...
Ngày tải lên: 09/08/2014, 13:22
Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"
... 3-5 days maintains the same efficacy. [25] Anyway, we may have favourable issues by changing the dose of ras- buricase, according to the various clinical states, the type of malignancy and drugs ... for DNA and RNA synthesis, and inosine that will be degraded into hypoxanthine and xanthine and finally into uric acid. Hypoxanthine and guanine may enter in a sal- vage pathway, using...
Ngày tải lên: 31/10/2012, 14:59
Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot
... Durante C, Cocchi M, Cossarizza A: Subject classification obtained by cluster analysis and principal component analysis applied to flow cytometric data. Cytometry A 2007, 71:334-344. 31. Casazza ... compartment syndrome. Circ J 2006, 70:1362-1364. 18. Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasak...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: " TSaT-MUSIC: a novel algorithm for rapid and accurate ultrasonic 3D localization" pdf
... obtain the DOA and delay values in a 2D space. By using an L-shaped ultrasonic sensor array as shown in Figure 4, TSaT-MUSIC can be extended to a 3D localization algorithm. We can estimate two angles, ... angles, θ a and θ b ,andonetime delay τ c by using two sensor arrays Aa and Ab, and the sensor Sc, respectively. The pairs of θ a and τ c ,andθ b and τ c can be decided by TSaT...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " Research Article A Novel Method for Improving Fairness over Multiaccess Channels" pdf
... BS, and s k is the symbol transmitted by the kth user. The additive noise ω is assumed to be white circular Gaussian with var iance N 0 /2foreachreal and imaginary component. Under the hypothesis ... the Average AME for the six methods which are compared. As it was already pointed out previously, OMA achieves always the maximum possible AME. We can notice from Figure 2(b) that SIC and...
Ngày tải lên: 21/06/2014, 11:20