Báo cáo y học: ": Network analysis of skin tumor progression identifies a rewired genetic architecture affecting inflammation and tumor susceptibility" docx

... KKL, and MDT. JPL contributed mice and tumor samples and KKL performed array analysis for the confirmation study. Taqman assays were performed by JS.Array CGH data were provided by DGA. The paper ... 184:119-128.doi:10.1186/gb-2011-12-1-r5Cite this article as: Quigley et al.: Network analysis of skin tumor progression identifies a rewired genetic architecture affecting inflammation and tumor susceptibility. Genome Biology 2011 12:R5.Submit ... elucidate the genetic architecture of cancer susceptibility. A combination of genetic and geneexpression analysis of human tumors will complement genetic association methods and may identify additionalsusceptibility...

Báo cáo y học: "Systematic analysis of genome-wide fitness data in yeast reveals novel gene function and drug action" pot

... lim-ited amount of available high-quality data relating to drugtargets in yeast. We collected two high-quality trainingsets: an expert-curated set of 83 yeast protein-compoundinteractions, and yeast ... correlation between co-inhibition and therapeuticuse might, in fact, be an underestimate because our cur-rent analysis is limited by the quality and quantity of thetherapeutic data available. ... perturbations [1] and show that the datasetreveals novel aspects of cellular physiology and provides a valuable resource for systems biology. In the haploinsuffi-ciency profiling (HIP) assay consisting...

Báo cáo y học: "Proteomic analysis of mechanisms of hypoxia-induced apoptosis in trophoblastic cells"

... JNK, PTEN, and caspase-3 mRNA quantities were analyzed in triplicate, normalized against GAPDH as a control gene and expressed in relation to a calibrator sample. Statistical analysis Experiments ... importance of Fas and FasL [15], and that of TNF-R1 and TNF-α[16], in preeclampsia. Thus, hypoxia-induced changes in the expression of both proapoptotic and antiapoptotic proteins, and the balance ... preeclampsia 1. Introduction Hypoxia of the placenta is a cause of various complications of pregnancy. Clinical conditions such as preeclampsia, anemia, and smoking can be accom-panied by villous...

Báo cáo y học: " Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphis"

... 2001;413(6853):316-22. 4. Yada M, Hatakeyama S, Kamura T, Nishiyama M, Tsunematsu R, Imaki H, Ishida N, Okumura F, Nakayama K, Nakayama KI. Phosphorylation-dependent degradation of c-Myc is mediated by the F-box ... Germany using the ABI PRISM Big Dye Terminator system (Applied Biosystems, Germany). Sequences were analyzed using the Chromas software (Technely-sium Pty Ltd, Tewantin, Australia) and GeneDoc ... Nakayama K, Oike Y, Nishiyama M, Ishida N, Hatakeyama S, Bessho Y, Kageyama R, Suda T, Nakayama KI. Mouse Fbw7/Sel-10/Cdc4 is required for notch degradation during vascular development. J Biol...

Báo cáo y học: " Transcriptome analysis of murine thymocytes reveals age-associated changes in thymic gene expression"

... G2565BA. Data was extracted using Agilent Feature Extractor Software (v7.1). Statistical data analysis. All data was processed a Z score statistical analysis method developed at NIA Int. ... 4.53 3.3 TTCATCCGTCACAGGAGTCA AGGAATTCGGAGCAGAGAC A chemokine (C-X-C motif) receptor 6 (Cxcr6) NM_030712 Cxcr6 2.49 7.91 3.98 4.7* AACAGCCAGGAGAACAAACG GGGCAAGTTCAGCAGAAACAdecorin (Dcn) ... TCGTTGGAGTGACATCGTCT GCTCCCACAATGAAGCATTT Actin, cyto-plasmic 1 (Beta-actin) NAP018710-001 B-actin 2.78 2.14 3.51 NC CTAAGGCCAACCGTGAAAAG CCATCACAATGCCTGTGGTA Mouse MHC class I H2-K-alpha-2...

Tài liệu Báo cáo Y học: Functional analysis of DM64, an antimyotoxic protein with immunoglobulin-like structure from Didelphis marsupialis serum pdf

... (M13F-cccagtcacgacgttgtaaaacg- and M13R-agcggataacaatttcacacagg) were fromLife Technologies, Inc. All other chemicals were of analy-tical grade or higher quality.Animals, venoms, and toxinsD. marsupialis ... Molecularmass standards were BSA (67 kDa), ovalbumin (43 kDa),chymotrypsinogen (25 kDa) and ribonuclease (13.7 kDa).Di-BSA (134 kDa) present in the BSA standard was alsoused as marker.Chemical ... such as myotoxin a and crotamine, which are not enzymatically active and aretypically found in Crotalus [5] and Sistrurus [7] venoms, (b)12–16 kDa phospholipase A 2(PLA2) myotoxins classiﬁedas...

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

... thermotoleranceJulie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRaeDepartment of Biology, Dalhousie University, Halifax, Nova Scotia, CanadaOviparously developing embryos of the brine shrimp,Artemia franciscana, ... chaperoning in vitro [66], and disassembly of active unitsfrom an oligomeric (storage) state of a- crystallin wasproposed, upon structural analysis of aA-crystallin by site-directed spin labelling, ... shock /a- crystallin protein from Artemia (Eur. J. Biochem. 269) 937Functional analysis of a small heat shock /a- crystallin proteinfromArtemia franciscanaOligomerization and thermotoleranceJulie...

Báo cáo Y học: The analysis of the ﬁne speciﬁcity of celiac disease antibodies using tissue transglutaminase fragments pot

... TGAAGCGAATTCTTACTCCAGGTAGAGGTCCCTCT 585–579C2 for TGAAGCGAATTCTTAGGCGGGGCCAATGATGAC 687–682Loop back AGCTCGAGATCTGGGTCCTCAGAGGAGAGGAG 448–453Core269back AGCTCGAGATCTTGCCAGCGCGTCAGGTATGGC ... AGCTCGAGATCTATGGCCGAGGAGCTGGTCTT 1–7Core back AGCTCGAGATCTAACGCCTGGTGCCCAGCGGA 140–147Core for TGAAGCGAATTCTTACTCCCTCTCCTCTGAGGACC 454–448Loop for TGAAGCGAATTCTTAACGGATCCGCATGGCCATCC ... Elisabetta Azzoni1, Trevin Zyla3, Min Park3, Valentina Baldas2,Tarcisio Not2, Alessandro Ventura2, Andrew Bradbury3,4 and Roberto Marzari11Dipartimento di Biologia, University of...

Báo cáo Y học: Structural analysis of Francisella tularensis lipopolysaccharide potx

... at the acylation site (Fig. 1). NOEbetween protons A2 and acyl1-2, and between B 2and acyl2-2 indicated that GlcN A is N-acylated with acyl1 ,and GlcN B is N-acylated with acyl2. All acyl ... disaccharide, carrying four acyl residues. GlcNresidue A had unsubstituted hydroxyl group at C-1, and wasmostly present in an a- pyranose form. Acyl1,acyl2 and acyl3residues had hydroxy ... 2002Structural analysis of Francisella tularensislipopolysaccharideEvgeny Vinogradov, Malcolm B. Perry and J. Wayne ConlanInstitute for Biological Sciences, National Research Council, Ottawa, CanadaThe...

Báo cáo Y học: Structural analysis of deacylated lipopolysaccharide of Escherichia coli strains 2513 (R4 core-type) and F653 (R3 core-type) pot

... HPAEC column.Elution and separation was achieved by a linear gradient of 2–600 mMNaOAc over a time of 70 min. Fractions wereanalyzed by analytical HPAEC and appropriately com-bined. Desalting ... shielded magnetandanApolloionsource.Samplesweredissolvedataconcentration of  10 ngÆlL)1in a 50 : 50 : 0.001 (v/v/v)mixture of 2-propanol, water, and triethylamine and sprayed at a ﬂow rate of ... Escherichia coli strain 2513 (R4core-type) yielded after alkaline deacylation one majoroligosaccharide by high-performance anion-exchange chro-matography (HPAEC) which had a molecular mass of 2486.59...

Xem thêm

Từ khóa: báo cáo y học báo cáo y học cổ truyền mẫu báo cáo y học cổ truyền bao cao y hoc colchicin phan ban luan trong bao cao y hoc co truyen báo cáo khoa học y học báo cáo y tế học đường mẫu báo cáo y tế học đường báo cáo y tế học đường cuối năm báo cáo y tế học đường năm 2012 báo cáo y tế học đường trường mầm non biểu mẫu báo cáo y tế trường học báo cáo y tế học đường trường tiểu học báo cáo y tế trường tiểu học báo cáo y tế trường học năm 2012 chuyên đề điện xoay chiều theo dạng Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP