Báo cáo y học: ": Network analysis of skin tumor progression identifies a rewired genetic architecture affecting inflammation and tumor susceptibility" docx

Báo cáo y học: ": Network analysis of skin tumor progression identifies a rewired genetic architecture affecting inflammation and tumor susceptibility" docx

Báo cáo y học: ": Network analysis of skin tumor progression identifies a rewired genetic architecture affecting inflammation and tumor susceptibility" docx

... KKL, and MDT. JPL contributed mice and tumor samples and KKL performed array analysis for the confirmation study. Taqman assays were performed by JS. Array CGH data were provided by DGA. The paper ... 184:119-128. doi:10.1186/gb-2011-12-1-r5 Cite this article as: Quigley et al.: Network analysis of skin tumor progression identifies a rewired genetic architecture...

Ngày tải lên: 09/08/2014, 22:23

11 431 0
Báo cáo y học: "Systematic analysis of genome-wide fitness data in yeast reveals novel gene function and drug action" pot

Báo cáo y học: "Systematic analysis of genome-wide fitness data in yeast reveals novel gene function and drug action" pot

... lim- ited amount of available high-quality data relating to drug targets in yeast. We collected two high-quality training sets: an expert-curated set of 83 yeast protein-compound interactions, and yeast ... correlation between co-inhibition and therapeutic use might, in fact, be an underestimate because our cur- rent analysis is limited by the quality and quantity of the therape...

Ngày tải lên: 09/08/2014, 20:21

17 328 0
Báo cáo y học: "Proteomic analysis of mechanisms of hypoxia-induced apoptosis in trophoblastic cells"

Báo cáo y học: "Proteomic analysis of mechanisms of hypoxia-induced apoptosis in trophoblastic cells"

... JNK, PTEN, and caspase-3 mRNA quantities were analyzed in triplicate, normalized against GAPDH as a control gene and expressed in relation to a calibrator sample. Statistical analysis Experiments ... importance of Fas and FasL [15], and that of TNF-R1 and TNF-α[16], in preeclampsia. Thus, hypoxia-induced changes in the expression of both proapoptotic and antiap...

Ngày tải lên: 31/10/2012, 15:12

9 499 0
 Báo cáo y học: " Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphis"

Báo cáo y học: " Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphis"

... 2001;413(6853):316-22. 4. Yada M, Hatakeyama S, Kamura T, Nishiyama M, Tsunematsu R, Imaki H, Ishida N, Okumura F, Nakayama K, Nakayama KI. Phosphorylation-dependent degradation of c-Myc is mediated by the F-box ... Germany using the ABI PRISM Big Dye Terminator system (Applied Biosystems, Germany). Sequences were analyzed using the Chromas software (Technely- sium Pty Ltd, Tewantin...

Ngày tải lên: 31/10/2012, 16:49

4 393 0
Báo cáo y học: " Transcriptome analysis of murine thymocytes reveals age-associated changes in thymic gene expression"

Báo cáo y học: " Transcriptome analysis of murine thymocytes reveals age-associated changes in thymic gene expression"

... G2565BA. Data was extracted using Agilent Feature Extractor Software (v7.1). Statistical data analysis. All data was processed a Z score statistical analysis method developed at NIA Int. ... 4.53 3.3 TTCATCCGTCACAGG AGTCA AGGAATTCGGAGCAGAGAC A chemokine (C-X-C motif) receptor 6 (Cxcr6) NM_030712 Cxcr6 2.49 7.91 3.98 4.7* AACAGCCAGGAGAA CAAACG GGGCAAGTTCAGCAGAAACA decorin (D...

Ngày tải lên: 03/11/2012, 11:35

14 464 0
Tài liệu Báo cáo Y học: Functional analysis of DM64, an antimyotoxic protein with immunoglobulin-like structure from Didelphis marsupialis serum pdf

Tài liệu Báo cáo Y học: Functional analysis of DM64, an antimyotoxic protein with immunoglobulin-like structure from Didelphis marsupialis serum pdf

... (M13F-cccagtcacgacgttg taaaacg- and M13R-agcggataacaatttcacacagg) were from Life Technologies, Inc. All other chemicals were of analy- tical grade or higher quality. Animals, venoms, and toxins D. marsupialis ... Molecular mass standards were BSA (67 kDa), ovalbumin (43 kDa), chymotrypsinogen (25 kDa) and ribonuclease (13.7 kDa). Di-BSA (134 kDa) present in the BSA standard was also u...

Ngày tải lên: 21/02/2014, 01:21

11 621 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx

... thermotolerance Julie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRae Department of Biology, Dalhousie University, Halifax, Nova Scotia, Canada Oviparously developing embryos of the brine shrimp, Artemia franciscana, ... chaperoning in vitro [66], and disassembly of active units from an oligomeric (storage) state of a- crystallin was proposed, upon structural analysis of...

Ngày tải lên: 22/02/2014, 04:20

10 495 0
Báo cáo Y học: The analysis of the fine specificity of celiac disease antibodies using tissue transglutaminase fragments pot

Báo cáo Y học: The analysis of the fine specificity of celiac disease antibodies using tissue transglutaminase fragments pot

... TGAAGC GAATTC TTACTCCAGGTAGAGGTCCCTCT 585–579 C2 for TGAAGC GAATTC TTAGGCGGGGCCAATGATGAC 687–682 Loop back AGCTCG AGATCT GGGTCCTCAGAGGAGAGGAG 448–453 Core 269 back AGCTCG AGATCT TGCCAGCGCGTCAGGTATGGC ... AGCTCG AGATCT ATGGCCGAGGAGCTGGTCTT 1–7 Core back AGCTCG AGATCT AACGCCTGGTGCCCAGCGGA 140–147 Core for TGAAGC GAATTC TTACTCCCTCTCCTCTGAGGACC 454–448 Loop for TGAAGC GAATTC TTAACGGATCCGCATGGCCAT...

Ngày tải lên: 08/03/2014, 09:20

7 506 0
Báo cáo Y học: Structural analysis of Francisella tularensis lipopolysaccharide potx

Báo cáo Y học: Structural analysis of Francisella tularensis lipopolysaccharide potx

... at the acylation site (Fig. 1). NOE between protons A2 and acyl 1 -2, and between B 2and acyl 2 -2 indicated that GlcN A is N-acylated with acyl 1 ,and GlcN B is N-acylated with acyl 2 . All acyl ... disaccharide, carrying four acyl residues. GlcN residue A had unsubstituted hydroxyl group at C-1, and was mostly present in an a- pyranose form. Acyl 1 ,acyl 2 and acyl 3 residu...

Ngày tải lên: 08/03/2014, 09:20

7 547 0
Báo cáo Y học: Structural analysis of deacylated lipopolysaccharide of Escherichia coli strains 2513 (R4 core-type) and F653 (R3 core-type) pot

Báo cáo Y học: Structural analysis of deacylated lipopolysaccharide of Escherichia coli strains 2513 (R4 core-type) and F653 (R3 core-type) pot

... HPAEC column. Elution and separation was achieved by a linear gradient of 2–600 m M NaOAc over a time of 70 min. Fractions were analyzed by analytical HPAEC and appropriately com- bined. Desalting ... shielded magnet andanApolloionsource.Samplesweredissolvedata concentration of  10 ngÆlL )1 in a 50 : 50 : 0.001 (v/v/v) mixture of 2-propanol, water, and triethylamine and...

Ngày tải lên: 08/03/2014, 09:20

10 545 0
w