Báo cáo y học: "Constructing a fish metabolic network model" pdf
... Set Enrichment Analysis (GSEA) and to two signaling path- ways (Wnt-beta-catenin and Ras-MAPK). We shall demonstrate here that MetaFishNet is a valuable addi- tion to the arsenal of microarray data analysis. The ... by KegArray. Additional file 8: Analysis of zebrafish liver cancer data by KEGG pathways and Fisher’s exact test. Additional file 9: Complete comparison between fish and human...
Ngày tải lên: 09/08/2014, 22:23
... cardiovascular disease. In addition, data on food in- take, basal energy expenditure (BEE), and total daily energy expenditure (TEE) were not available for analysis that may have provided a ... demonstrated that hypoalbu- minemia was a strong predictor of mortality in dialysis patients. Kalantar-Zadeh et al (34) also showed higher mortality in dialysis patients with lower albumin. M...
Ngày tải lên: 03/11/2012, 11:52
... 15, 431–440. 55.Jin,D.,Takai,S.,Yamada,M.,Sakaguchi,M.,Yao ,Y. & Miyazaki, M. (2001) Possible roles of cardiac chymase after myocardial infarction in hamster hearts. Jpn. J. Pharmacol. 86, 203–214. 56. Miyazaki,M.,Wada,T.,Shiota,N.&Takai,S.(1999)Effectofan angiotensin ... Biomedical Research, Hino, Tokyo, Japan; 2 TEIJIN Material Analysis Research Laboratories, Tokyo, Japan; 3 Center f...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx
... forward primer D11–13 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢)and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; ... D11-13 mutant; forward primer F1 (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse pri- mer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to generate the pnPT...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot
... arrow). Y5 1 AMY2 and Y8 2 TAA are in orange. Other binding residues (W9 AMY2 , H92 AMY2 , T94 AMY2 , A9 5 AMY2 , Y1 30 AMY2 , A1 45 AMY2 , F180 AMY2 , K182 AMY2 , W206 AMY2 , S208 AMY2 , Y2 11 AMY2 , ... TAA (in black). The superimpositioning was guided by the catalytic acids (D179 AMY2 , E204 AMY2 , and D289 AMY2 and D206 TAA , E230 TAA , and D297 TAA ). The invariant Y5 1 AMY2 and...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo Y học: LRP130, a protein containing nine pentatricopeptide repeat motifs, interacts with a single-stranded cytosine-rich sequence of mouse hypervariable minisatellite Pc-1 docx
... and 3-methylcholanthrene, detected by a DNA fingerprint assay. Cancer Res. 52, 5788–5793. 12. Kitazawa, T., Kominami, R., Tanaka, R., Wakabayashi, K. & Nagao, M. (1994) 2-Hydroxyamino-1-methyl-6-phenylimidazo- [4,5,-b]pyridine ... Fukuda, Takashi Sugimura, Minako Nagao and Hitoshi Nakagama Biochemistry Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan Recently, w...
Ngày tải lên: 31/03/2014, 23:20
Báo cáo y học: "Fluoxetine: a review on evidence based medicine" pdf
... disorder: A meta-analysis. Acta Psychiatrica Scandinavica 2002, 106(3):163-167. 11. Khan A, Leventhal RM, Khan S, Brown WA: Suicide risk in patients with anxiety disorders: A meta-analysis of the FDA ... Barraco and Pietro Donda Address: Medical Dept. Eli Lilly Italia S.p .A. via Gramsci, 731, Sesto fiorentino (Florence), Italy Email: Andrea Rossi* - rossi_andrea _a@ lilly.com; Alessandr...
Ngày tải lên: 08/08/2014, 20:23
Báo cáo y học: "Urokinase, a constitutive component of the inflamed synovial fluid, induces arthritis" pps
... Synovial hyper- trophy was defined as a synovial membrane thickness of more than two cell layers. The intensity of inflammatory cell infiltration of the synovia (arthritis index) was graded arbi- trarily ... were coded and evaluated blindly by two investigators with respect to synovial hypertrophy, to the inflammatory cell infiltration of the synovia, to pannus formation, and to carti- lage...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Mactinin: a modulator of the monocyte response to inflammation" pps
... http://arthritis-research.com/content/5/6/R310 R315 20. Fujikawa Y, Sabokbar A, Neale S, Athanasou NA: Human osteo- clast formation and bone resorption by monocytes and syn- ovial macrophages in rheumatoid arthritis. Ann Rheum Dis 1996, ... NaCl, pH 7.5, and sequentially treated with affinity-purified rabbit antisera raised against recombinant mactinin, followed by second antibody conjugate...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Citrullination, a possible functional link between susceptibility genes and rheumatoid arthritis" ppsx
... Sawada T, Suzuki M, Nagasaki M, Nakayama-Hamada M, Kawaida R, Ono M, Ohtsuki M, Furukawa H, Yoshino S, Yukioka M, Tohma S, Matsubara T, Wakitani S, Teshima R, Nishioka Y, Sekine A, Iida A, Takahashi ... 5 PADI4, encoding citrullinating enzyme peptidylarginine deimi- nase 4, are associated with rheumatoid arthritis. Nat Genet 2003, 34:395-402. 8. Nakashima K, Hagiwara T, Yamada M: Nuclear l...
Ngày tải lên: 09/08/2014, 01:23