báo cáo khoa học: "Heritability of a canalized trait: teat number in Iberian Teresa pigs" pptx

Báo cáo khoa học: Production of a recombinant mouse monoclonal antibody in transgenic silkworm cocoons pptx

Báo cáo khoa học: Production of a recombinant mouse monoclonal antibody in transgenic silkworm cocoons pptx

... 5. Analysis of N-glycans in the recombinant mAb by lectin blot- ting. Recombinant mAb was subjected to lectin blotting with AAL and concanavalin A. The purified recombinant mAb (R) and standard human ... 0.1 a Copy numbers of mRNAs of L-chain and H-chains of the recombi- nant IgG, and sericin-1 per 10 ng of total RNA. The indicated values are 10 )5 of the actual copy numbers....

Ngày tải lên: 23/03/2014, 04:20

15 263 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... (Govt. of India) for partial financial support. The authors thank Dinesh Kumar for recording the scan- ning electron micrographs and Shivcharan Prasad and Pinakin Makwana for technical assistance. References 1 ... damage [33,34]. The co-administration of antioxidants like coenzyme Q and creatine has also been shown to be beneficial against a- synuclein aggregation in the substantia nigra...

Ngày tải lên: 14/02/2014, 19:20

11 754 0
Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc

Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc

... Hayashi M, Inomata M, Nakamura M, Maruya M & Iwashita S (2004) Perfringolysin O, a cholesterol-binding cytolysin, as a probe for lipid rafts. Anaerobe 10, 125–134. 19 Waheed AA, Shimada Y, Heijinen ... Nakamura M, Inomata M, Hayashi M, Iwashita S, Slot JW & Ohno- Iwashita Y (2001) Selective binding of perfringolysin O derivative to cholesterol-rich membrane microdomains (rafts)....

Ngày tải lên: 20/02/2014, 03:20

10 589 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300 CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTG...

Ngày tải lên: 07/03/2014, 16:20

12 772 0
Báo cáo khoa học: Evidence of a new phosphoryl transfer system in nucleotide metabolism doc

Báo cáo khoa học: Evidence of a new phosphoryl transfer system in nucleotide metabolism doc

... containing various amounts of AdK (0.1–4.0 nmol in a final volume of 0.25 mL) and a fixed amount of MK (0.0008 nmol) in the absence of ADA. Inset: Scatchard plot. D. Vannoni et al. Formation of ADP ... revealed the disap- pearance of ADP and the formation of an ATP peak, which was identified in the chromatogram using the same criteria as for ADP and inosine. CE analysis A...

Ngày tải lên: 23/03/2014, 06:20

15 378 0
Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx

Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx

... HvALP suggested lack of terminal galactose, c onfirming that SBA and WFL were binding to a terminal GalNAc residue. Terminal GalNAc in glycoproteins is usually part of an O-linked glycan [34]. Interestingly, ... 4GlcNAc 0.2 M Gal Gala1 fi 3Gal Dolichus biflorus (DBA) GalNAca1 fi 3GalNAc 0.2 M GalNAc GalNAca1 fi 3Gal Sophora japonica (SJA) Galb1 fi 3GalNAc 0.2 M Gal Galb1 fi 3,4GlcNAc Wistari...

Ngày tải lên: 23/03/2014, 13:20

9 400 0
Báo cáo khoa học: "Choice of a model for height-growth in maritime pine curves" pps

Báo cáo khoa học: "Choice of a model for height-growth in maritime pine curves" pps

... variability. From an examination of nearly 4 000 curves we observed that they generally have a regular sigmoidal shape, with an inflexion point at about 10 years and an ... Sprinz et al, 1987; Magnussen, 1993). A well- known advantage of these models is that they can provide an efficient summary of the data via a small number of meani...

Ngày tải lên: 08/08/2014, 19:21

10 280 0
Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc

Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc

... Mexican origin. The index case was a 23-year-old female diagnosed with breast carci- noma of the left breast with combined histological fea- tures of lobular carcinoma and infiltrating ductal carcinoma. ... sarcoma, osteosarcoma, brain tumor, pre-menopausal breast cancer, adrenocortical car- cinoma, leukemia, lung bronchioloalveolar carcinoma) prior to the age of 46 years and at least...

Ngày tải lên: 09/08/2014, 04:21

7 403 0
Báo cáo khoa hoc:"Heritability of susceptibility to Salmonella enteritidis infection in fowls and test of the role of the chromosome carrying the NRAMP1 gene" ppt

Báo cáo khoa hoc:"Heritability of susceptibility to Salmonella enteritidis infection in fowls and test of the role of the chromosome carrying the NRAMP1 gene" ppt

... after an oral inoculation in [14]. Correlations between the logarithms of the number of Salmonella per organ and of the number of Salmonella per gram of organ were very high since the range of variation ... response to bacterial lipopolysaccharide, an abundant component of the bacterial membrane of Gram-negative bacteria, including Salmonella.Hu et al. [12] showed that t...

Ngày tải lên: 09/08/2014, 18:21

9 553 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m TGGGAATACGATAGAGTAG nb2 primer GTTTAAACGAGCTCGAATTC Coq7 in fission yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG Spcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG Spcoq3-z GTATGCGATGTGGAATTTG Spcoq3-m GATGCCTTCCAATGAATTAC cyc1-w GAACCAATGAAATAAGGGCG cyc1...

Ngày tải lên: 18/02/2014, 14:20

16 646 0
Từ khóa:
w