Báo cáo y học: "mRNA: a complex(ed) life" pptx
Báo cáo y học: "mRNA: a complex(ed) life" pptx
... unstable transcripts via a short poly (A) tail of four adenosines and target them for rapid decay mediated by the TRAMP complex. Tollervey introduced cross-linking and analysis of cDNAs (CRAC) ... surprisingly, shown to control alternative polyadenylation in addition to mRNA decay. All classes of RNA are subject to mechanisms of surveil lance, which remove aberrant or nonfunctional...
Ngày tải lên: 09/08/2014, 20:22
Báo cáo y học: "Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences" ppsx
... of 13 are examples of metadata) - to repeat an analysis exactly. When a user performs an analysis using Galaxy, it automatically generates metadata for each analysis step. Galaxy’s metadata includes ... reproducible research system. Acknowledgements Galaxy is developed by the Galaxy Team: Enis Afgan, Guruprasad Ananda, Dannon Baker, Dan Blankenberg, Ramkrishna Chakrabarty, Nate Coraor, Jere...
Ngày tải lên: 09/08/2014, 20:22
Báo cáo y học: "Surgical management of life threatening events caused by intermittent aortic insufficiency in a native valve: case report" ppsx
... he had another acute event again characterized by hypotension, followed by desaturation and bradycardia. Echocardiogram at our institution was normal. A planned pre-tra nsplant cathe- terization ... H Martin 1 , Stanton B Perry 1 , James V Prochazka 2 , Frank L Hanley 3 , Norman H Silverman 1* Abstract We describe a case of a patient admitted with apparent life threatening events charac...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo y học: "Typhoid ulcer causing life-threatening bleeding from Dieulafoy''''s lesion of the ileum in a seven-year-old child: a case report" doc
... seven-year-old child: a case report Rajan Fuad Ezzat* 1 , Hiwa A Hussein 2 , Trifa Shawkat Baban 3 , Abbas Tahir Rashid 1 and Khaled Musttafa Abdullah 1 Abstract Introduction: We describe a case ... Iraq, 2 Department of Medicine, Sulaimanyah Teaching Hospital, Sulaimanyah, Iraq and 3 Department of Pathology, Sulaimanyah Teaching Hospital, Sulaimanyhah, Iraq References 1. Parry CM...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: " Science – A life fully lived: Joe Sodroski wins the 2006 Retrovirology Prize" pptx
... became clear that human T-cell leukemia viruses (HTLVs) were induc- ing leukemias/lymphomas in humans by a mechanism that fundamentally differed from those employed by either leukemia or sarcoma ... Bill taught me the power of rigorous thinking to reveal answers and clarify murky research areas. AMLL. You clearly have enormous enthusiasm for your work. What is it about science that keeps yo...
Ngày tải lên: 13/08/2014, 09:20
Báo cáo y học: "Hypoalbuminaemia – A Marker of Cardiovascular Disease in Patients with Chronic Kidney Disease Stages II - IV"
... cardiovascular disease. In addition, data on food in- take, basal energy expenditure (BEE), and total daily energy expenditure (TEE) were not available for analysis that may have provided a ... demonstrated that hypoalbu- minemia was a strong predictor of mortality in dialysis patients. Kalantar-Zadeh et al (34) also showed higher mortality in dialysis patients with lower albumin. M...
Ngày tải lên: 03/11/2012, 11:52
Báo cáo Y học: Rodent a-chymases are elastase-like proteases pot
... 15, 431–440. 55.Jin,D.,Takai,S.,Yamada,M.,Sakaguchi,M.,Yao ,Y. & Miyazaki, M. (2001) Possible roles of cardiac chymase after myocardial infarction in hamster hearts. Jpn. J. Pharmacol. 86, 203–214. 56. Miyazaki,M.,Wada,T.,Shiota,N.&Takai,S.(1999)Effectofan angiotensin ... Biomedical Research, Hino, Tokyo, Japan; 2 TEIJIN Material Analysis Research Laboratories, Tokyo, Japan; 3 Center f...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx
... forward primer D11–13 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢)and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; ... D11-13 mutant; forward primer F1 (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse pri- mer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to generate the pnPT...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot
... arrow). Y5 1 AMY2 and Y8 2 TAA are in orange. Other binding residues (W9 AMY2 , H92 AMY2 , T94 AMY2 , A9 5 AMY2 , Y1 30 AMY2 , A1 45 AMY2 , F180 AMY2 , K182 AMY2 , W206 AMY2 , S208 AMY2 , Y2 11 AMY2 , ... TAA (in black). The superimpositioning was guided by the catalytic acids (D179 AMY2 , E204 AMY2 , and D289 AMY2 and D206 TAA , E230 TAA , and D297 TAA ). The invariant Y5 1 AMY2 and...
Ngày tải lên: 31/03/2014, 08:20