A novel family of P-loop NTPases with an unusual phyletic distribution and transmembrane segments inserted within the NTPase domain pot
... information Open Access 2004Aravindet al.Volume 5, Issue 5, Article R30 Research A novel family of P-loop NTPases with an unusual phyletic distribution and transmembrane segments inserted within the NTPase ... pro- tein. The apparent preponderance of horizontal gene transfer in the evolution of the KAP family and the phylogenetic affin- itie...
Ngày tải lên: 09/08/2014, 20:20
... fractions were separately pyridylaminated and designated endoH-PA, PNGaseF-PA, PNGaseA-PA and Hyd(HFA)-PA, respect- ively. Analytical anion-exchange HPLC of the pyridyl- aminated oligosaccharide pools ... terminal galactose, 6-substi- tuted mannose and 4-substituted GlcNAc (Table 2). The Y 4a and Y 3a ions at m/z 996 and 834 obtained by ESI-IT- MS/MS analysis are in agreem...
Ngày tải lên: 31/03/2014, 08:20
... src="data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAA94AAAWQCAIAAAAjjQtaAAAACXBIWXMAABYlAAAWJQFJUiTwAAAYCUlEQVR42uzYMRUAIAxDQcqMTVzhNV3w0OVOQqb/Uue+BQAATNsmAAAAaQ4AAHyVxAoAADDOaw4AANIcAACQ5gAAIM0BAABpDgAA0hwAAJDmAAAgzQEAAGkOAADSHAAAkOYAACDNAQAAaQ4AANIcAACQ5gAAIM0BAABpDgAA0hwAAJDmAAAgzQEAAGkOAADSHAAAkOYAACDNAQAAaQ4AANIcAACQ5gAAIM0BAABpDgAA0hwAAJDmAAAgzQEAAGkOAABIcwAAkOYAAIA0BwAAaQ4AAEhzAACQ5gAA...
Ngày tải lên: 08/08/2014, 18:20
Báo cáo khoa học: "Generating Templates of Entity Summaries with an Entity-Aspect Model and Pattern Mining" potx
... Evaluation Because we study a non-standard task, there is no existing annotated data set. We therefore created a small data set and made our own human judgment for quantitative evaluation purpose. 5.1 Data We ... entity categories and compare our method with two baseline methods. Both quantitative evaluation based on human judgment and qualitative comparison demonstrate the ef-...
Ngày tải lên: 23/03/2014, 16:20
Báo cáo hóa học: " Research Article A New General Iterative Method for a Finite Family of Nonexpansive Mappings in Hilbert Spaces Urailuk Singthong1 and Suthep Suantai1, 2" potx
... referees for valuable suggestions on the paper and thank the Center of Excellence in Mathematics, the Thailand Research Fund, and the Graduate School of Chiang Mai University f or financial support. References 1 ... Spaces Urailuk Singthong 1 and Suthep Suantai 1, 2 1 Department of Mathematics, Faculty of Science, Chiang Mai University, Chiang Mai 50200, Thailand 2 PERD...
Ngày tải lên: 21/06/2014, 11:20
Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt
... from Oriental Yeast (Tokyo, Japan). Restriction enzymes and kits for genetic manipulation were from Takara Shuzo (Kyoto, Japan), Toyobo (Osaka, Japan), and New England Biolabs (Beverly, MA, USA). All other ... other reagents were of analytical grade from Nacalai Tesque (Kyoto, Japan) and Wako Pure Chemical Industries (Osaka, Japan). Culture and screening of bacteria Bacterial stra...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: A novel inhibitor of indole-3-glycerol phosphate synthase with activity against multidrug-resistant Mycobacterium tuberculosis pptx
... energy values were selected from the 60 000 ligands, and 50 of them were purchased and used in further evaluation of their antimycobacterial activities. Antimycobacterial activities of the selected ligands ... CCAATGCGCCTGCCGCAGGACTAGCG Glu168 fi Ala Up: CAGCACTCGTCGCGGTCCATACCGAG Down: CTCGGTATGGACCGCGACGAGTGCTG Val169 fi Ala Up: CACTCGTCGAGGCCCATACCGAGCAG Down: CTGCTCGGTATGGGCCT...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc
... dorso- medial part of the OP and OE, whereas the NeuroD and NCAM transcripts are found in the entire OP and OE areas. The o-macs transcripts are found in all cell layers of the OP andOEincontrasttotheNCAM ... to produce acyl-CoA on the outer membrane of mitochondria. Acyl-CoA is then transported into the matrix for b-oxidation of acyl-group. Among the MACS famil...
Ngày tải lên: 08/03/2014, 02:20
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
... TCG AGC CCC-3¢;antisense:5¢-GGG GCT CGA GAA AAA AAA AAAGAAAGAAAGAAAGAAAGAAAGAAA GAA AGA AAG AAA GAA AGG AAT TCG GGC CCG GGG-3¢) representing base pairs 1830–1881 of the MARCKS cDNA [38] and cloning ... overexpression of HuD (lane 4) and HuR (lane 6) (upper panel). Staining of the gel with ethidium bromide revealed equal loading of the gel and integrity of the RNA (lo...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx
... A 260 and A 280 values were determined. The RNA quality and quantity was determined with the Agilent 2100 Bioanalyser and the 2100 expert software. RT-PCR First-strand synthesis was carried out with ... centrifugation (Amicon, 10 kDa cut-off) and the polypeptide migra- ting with an apparent molecular mass of 80 kDa in the SDS ⁄ PAGE analysis of the concentr...
Ngày tải lên: 23/03/2014, 11:20