Characterization of Indian cattle breeds, Ongole and Deoni (Bos indicus) using microsatellite markers pot

... Environment Foundation. All rights reserved. Biochemical characterization of thermophilic lignocellulose degrading enzymes and their potential for biomass bioprocessing Vasudeo Zambare 1 , Archana ... of thermophilic consortia for cellulase and xylanase production [7, 27]. These reports, however, lack information on the biochemical and kinetic prope...

Ngày tải lên: 05/09/2013, 16:11

... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b. ... (AtRPA7 0a and AtRPA70b, respectively) and because many T-DNA insertion mutants of A. thali- ana are already available [26]. We were able to obtain one T-DNA insertion line each for...

Ngày tải lên: 07/03/2014, 21:20

... 2003 Characterization of presenilin complexes from mouse and human brain using Blue Native gel electrophoresis reveals high expression in embryonic brain and minimal change in complex mobility with pathogenic ... or from cases with presenilin 1 missense mutations, indicated no change in presenilin 1 complex mobility. H...

Ngày tải lên: 16/03/2014, 16:20

... Sahin et al. (Eur. J. Biochem. 271) Ó FEBS 2004 Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation Bogachan Sahin 1 , Janice ... E-mail: james.bibb@utsouthwestern.edu Abbreviations: AK, adenosine kinase; Ado, adenosine; hAK, human adenosine kinase; mAK, mouse adenosine kinase. Note...

Ngày tải lên: 16/03/2014, 18:20

... 50075020 ê 2008 The Authors Journal compilation ª 2008 FEBS Expression and characterization of the biofilm-related and carnosine-hydrolyzing aminoacylhistidine dipeptidase from Vibrio alginolyticus Ting-Yi ... examined the V. alginolyticus PepD protein. In the present study, we present the cloning and expression of the V. alginolyti- cus pepD gene,...

Ngày tải lên: 23/03/2014, 06:20

... 2006 The Authors Journal compilation ê 2006 FEBS Characterization of a b-N-acetylhexosaminidase and a b-N-acetylglucosaminidase/b-glucosidase from Cellulomonas fimi Christoph Mayer 1,2,3 , David ... UniProt database and the organism codes: NagA of Streptomyces thermoviolaceus (Q82840 ⁄ NAGA_STRTH) and HexA from Alteromonas sp. (P48823 ⁄ HEXA_ALTSO) and the sequ...

Ngày tải lên: 30/03/2014, 10:20

... Detection and characterization of translational research in cancer and cardiovascular medicine. Journal of Translational Medicine 2011 9:57. Submit your next manuscript to BioMed Central and take ... leading journals in cancer and cardiovascular medicine. For cancer, we used JCR’s “Oncology” cate- gory. For cardiovascular medicine, we combined “Car- diac &am...

Ngày tải lên: 18/06/2014, 19:20

... elopments in cancer research in the 1990s, including rapid advances in understanding of cancer genetics and increasing use of surface antigens to characterize cell types, yielded a hybrid of applied and ... analysis – to investigate the emergence, struc- ture, and content of translational research in bi omedi- cine by comparing research in cancer and c...

Ngày tải lên: 20/06/2014, 03:20

... 6:187 http://www.nanoscalereslett.com/content/6/1/187 Page 9 of 9 NANO EXPRESS Open Access Growth and characterization of gold catalyzed SiGe nanowires and alternative metal -catalyzed Si nanowires Alexis Potié 1,3* , Thierry Baron 1* , ... this article as: Potié et al.: Growth and characterization of gold catalyzed SiGe nanowires and alternative...

Ngày tải lên: 21/06/2014, 05:20

... lattice structure. Conclusion We employed a combination of nanoindentation and AFM techniques to investigate the contact-induced deformation behavior of GaN films on c- and a-axis sapphire substrates. We ... forces and values of l determined from nanoscratch trace depths within GaN films on c- and a-axis sapphire substrates Sample Normal load (lN) Coefficient...

Ngày tải lên: 21/06/2014, 08:20

... forms of P in non -fertilized and P -fertilized soils (figure 1). As can be seen in table IV and table V, in FG and VR soils, the concentrations of P i forms in fertilized soils were lower than in ... diester-P in the clay and silt frac- tions from mineralization and explain the higher diester proportion observed in VR and NF soils than in SM and FG (tab...

Ngày tải lên: 08/08/2014, 14:21

... statistics. Journal of Heredity 1995, 86: 485-486. Characterization of Indian cattle breeds, Ongole and Deoni (Bos indicus) using microsatellite markers Authors: Muralidhar Metta 1 , Sriramana ... 076, INDIA. Running Title: Characterization of Indian cattle breeds, Ongole and Deoni (Bos indicus) using micr...

Ngày tải lên: 09/08/2014, 20:20

... 17:91 http://www.jbiomedsci.com/content/17/1/91 Page 9 of 9 RESEA R C H Open Access Regional characterization of energy metabolism in the brain of normal and MPTP-intoxicated mice using new markers of glucose and phosphate transport Emmanuelle ... in the brain of normal and MPTP- intoxicated mice. Pi and glucose represent key molecule...

Ngày tải lên: 10/08/2014, 05:21

... At2g27830 BT5 UGT73B5 At1g08940 ATSERAT2;1 At4g20830 BIK1 Ca- and calmodulin binding and related proteins Calmodulin related and of similar protein Calmodulin binding and of similar protein Ca-binding protein and of similar protein Heat shock protein Transcription ... Plant Biology Open Access Research article Comparative transcriptomic characterization of aluminum,...

Ngày tải lên: 12/08/2014, 03:20

... of 14 (page number not for citation purposes) Retrovirology Open Access Research Characterization of two candidate genes, NCoA3 and IRF8, potentially involved in the control of HIV-1 latency Sandie ... microarray analysis was to iden- tify candidate genes potentially involved in the control of the HIV latency. For this reason, we decided to focu...

Ngày tải lên: 13/08/2014, 09:21