Báo cáo sinh học: " Modelling and optimizing of sequential selection schemes: a poultry breeding application" ppt
... is obtained forV!(!). A matrix formulation of [14] is Go and Go!i! are, respectively, the initial and asymptotic matrices of genetic variances and covariances. As explained ... mean of performances of each hatch. Also, as shown by Andersen (1994), we have in such a situation: Thus the calculation is tantamount to the computation of th...
Ngày tải lên: 09/08/2014, 18:22
... independently associ- ated with an increased occurrence of MODS and pro- longed PICU stay. • These novel and important observational data jus- tify undertaking a randomized controlled trial to eval- uate ... infection: a meta-analysis. J Trauma 2003, 54:908-914. 11. Vamvakas EC, Blajchman MA: Universal WBC reduction: the case for and against. Transfusion 2001, 41:691-712. 12. Sh...
Ngày tải lên: 13/08/2014, 20:21
... their support and coopera- tion. We thank Mary Banda (Lusaka Urban District Health Management Team) and Graham Samungole (Lusaka Urban District Health Management Team) for their assistance in study ... study implementation and recruitment. We thank Moffat Zulu and Martin Daka of CIDRZ for providing data manage- ment and data entry assistance. We acknowledge the Zambian Ministry...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx
... Amaro-Carambot for assistance with sequencing. We are grateful to Pamela Shaw and Dean Follman for assistance with statistical analysis. We also thank Brad Finneyfrock and Marisa St. Claire at ... ≤40°C. Evaluation of replication of viruses in AGMs and efficacy against challenge AGMs in groups of two to four animals at a time were inoculated intranasally (i.n.) and intratra...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Detection and frequency of recombination in tomato-infecting begomoviruses of South and Southeast Asia" pptx
... Vegetable Research, P B 5002, P 0-B H U, Varanasi, Uttar Pradesh, 221005, India Email: HC Prasanna* - prasanahc@yahoo.com; Mathura Rai - mathura.rai@gmail.com * Corresponding author Abstract Background: ... Journal Open Access Research Detection and frequency of recombination in tomato-infecting begomoviruses of South and Southeast Asia HC Prasanna* and Mathura Rai Address: Indian...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Construction and characterization of recombinant flaviviruses bearing insertions between E and NS1 genes" docx
... genes MyrnaCBonaldo* 1 , Samanta M Mello 1 , Gisela F Trindade 1 , Aymara A Rangel 2 , Adriana S Duarte 1 , Prisciliana J Oliveira 1 , Marcos S Freire 2 , Claire F Kubelka 3 and Ricardo Galler 2 Address: ... ACGAGCTGTACAAGAAGTT- GTTCACTCAGACCATGAAAGGC 3') and RG331 (5'GCC AAAGTTGATGGCGCATCCTTGATCGGCGCCAACTCCTA GAGAC 3'). This fragment included 24 nucleotides from the c...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: "Construction and characterization of an infectious clone of coxsackievirus A16" docx
... Xba I CV(1–4392) amplification P3 CTACGCTCTAGAAAGAAGGA Xba I CV(4381–7410) amplification P4 ACAAGCGGCCGCTGCTATTCTGGTTATAAC Not I CV(4381–7410) amplification P5 CTTCTCGAGGTTGATTTTGAGCAAGCATTG ... equally Abstract Background Coxsackievirus A1 6 (CVA16) is a member of the Enterovirus genus of the Picornaviridae family and it is a major etiological agent of hand, foot, and m...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Development and implementation of explicit computerized protocols for mechanical ventilation in children" pot
... acceptance and implementation of ECPs. These barriers include the lack of awareness, lack of familiarity with the protocol, lack of agreement, lack of demonstrated safety and efficacy, lack of ... The mismatch between human ability and the vast amount of data and information contributes to variation in clinical practice as decisions are made applying different data co...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: "Safety and pharmacokinetics of recombinant human hepatocyte growth factor (rh-HGF) in patients with fulminant hepatitis: a phase I/II clinical trial, following preclinical studies to ensure safety" ppt
... Nakayama H, Gohda E, Arakaki N, Sakiyama O, Takahashi K, Kimoto M, Kawasaki S, Setoguchi M, Tachikawa T, Shin S, Arima T, Daikuhara Y: Levels of the human hepatocyte growth factor in serum of ... Hashiya N, Makino H, Yamasaki K, Azuma J, Sawa Y, Matsuda H, Kaneda Y, Ogihara T: Safety evaluation of clinical gene therapy using hepatocyte growth factor to treat peripheral arterial disease....
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: "Detection and characterization of translational research in cancer and cardiovascular medicine"Ơ docx
... reponderance of clinical articles and journals in the car diac liter ature: clinical journals dominate a larger area of the cardiac map than the cancer map. Of the 75 most active cardiac journals, a ... importance of standardization and regulatory tools for both research and clinical care[34]. Citation a nalysis also reveals evidence of ritual use of citations. It is l...
Ngày tải lên: 18/06/2014, 19:20