0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo sinh học: " A simulation study of the effect of connectedness on genetic trend" potx

Báo cáo sinh học:

Báo cáo sinh học: " A simulation study of the effect of connectedness on genetic trend" potx

... only a limited picture of the effect of connectedness. The analytical study of the effect of connectedness on response to selectionrequires the calculation of selection ... that subpopulations are largeenough. The lack of connection induces a large bias in the estimation of the genetic level of the subpopulations, because the differences among ... population.Another more classical interpretation of the advantage of using connections toincrease genetic trend is the increase in genetic variance, due to the additionalbetween-subpopulations...
  • 16
  • 238
  • 0
báo cáo sinh học:

báo cáo sinh học:" A framework for evaluating the impact of the United Nations fellowship programmes" ppt

... andimplementation of the training programme and evalua-tion of the long term benefits to particular target groupsand the social system at large.Basing an impact evaluation framework on the strength of ... maynotbeabletoprovidethecasualrelationsamongvari-ables leading to an impact, it could establish a ‘plaus ibleassociation’ whereby a ‘reasonable person , knowing whathas occurred in the programme and ... achieve and hence needto monitor and evaluate. The contribution analysis approachThenotionofmappingthepathwaytowardshigherlevel goals is consistent with Mayne’s Contribution Ana-lyses approach...
  • 8
  • 520
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " A critical assessment for the value of markers to gate-out undesired events in HLA-peptide multimer staining protocols" pot

... data, performed data analysis,did the visual evaluation of all dot plots and wrote parts of the manuscript.LP coordinated the collection and assembly of data, did all statistical analysisand ... a large fraction of representative proto-cols the addition of a DUMP channel to a dead cell dyemayhavefavourableeffects.Inasmallfraction(1 5of 100) of paired replicates we observed an increase ... Representative dot plots from all participatinglabs will be made available upon request.Data Analysis and InterpretationData generated by individual laboratories were evaluatedin 2 waysInitial analysis...
  • 13
  • 752
  • 0
Báo cáo y học:

Báo cáo y học: "A case study evaluating the use of clozapine in depression with psychotic feature" docx

... effects.There was no standardisation of treatment given prior to clozapine administration. There was no comparison group or long term follow up of patients.Banov MD, Zarate CA Jr, Tohen M, Scialabba ... chlorpromazine and olanzap-ine medication were stopped and she was started on haloperidol and amitriptyline. Two days later, she startedexperiencing second person auditory hallucinations of the rapist ... for the 4 months preceding the admis-sion. The ECT continued after she was admitted. Her med-ication was:Lithium carbonate 1000 mg once dailyMirtazapine 60 mg at nightOlanzapine 20 mg at...
  • 6
  • 495
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "A case study of the College English Test and ethnic minority university students in China: negotiating the final hurdle" pptx

... Instead of a certificate, students whoscoreabove220areawardedatranscriptissuedbytheNationalCET-4andCET-6Commission on behalf of the Department of Higher Education of the National Minis-try of Education ... Xia is an Associate Professor in the School of Foreign Languages for International Business at the ShanghaiInstitute of Foreign Trade, and a doctoral student in the Faculty of Languages at Hong ... 1:1http://www.multilingual-education.com/1/1/1Page 11 of 11Authors’ contributionsBoth BA and BX contributed to the conception, design, collection, analysis and interpretation of data. Both authorsread and approved the final manuscript.Authors’...
  • 11
  • 649
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " A comparative study of some methods for color medical images segmentation" pdf

... segmentation the errormeasures are calculated in relation with manual segmentation. The GCE andLCE demonstrate that the image segmentation based on an HS produces a better segmentation than the back-projection ... them are well known: the color set back-projection algorithm and the local variation algorithm. The 8 A feature space is the range space of any function of the image, with the most common feature ... as the sum between the average of the color distances associated to edges (between the adjacent hexagons) and the standard deviation of these color distances.Figure 5 presents the repartition...
  • 42
  • 349
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "A reduced animal model with elimination of quantitative trait loci equations for marker-assisted selection" pdf

... animals which have the marker data or provide relationship tiesamong descendant animals with known marker data. An appropriate covariance matrix of the residual effects ... to the sire and the dam of animal i, and G, is a block diagonalmatrix (Saito and Iwaisaki, 1996) in which each block is calculated aswhere fi is the conditional ... equations for suchanimals can be eliminated, showing that the inverse of a covariance matrix among the total additive genetic merits and the needed additive effects of...
  • 13
  • 275
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc

... practical purposes, we can not claim that our algorithm is capable of finding all the fine grained distinctions that are listed in manually created dictionaries such as the Longman Dictionary ... of speech of the context words are considered. By op-erating on a part -of- speech tagged corpus those sense distinctions that have an effect on part of speech can be taken into account. Acknowledgements ... almost all cases the local context of an ambiguous word is sufficient to disambiguate its sense. This means that the local context of a word usually carries no ambiguities. The aim of this paper...
  • 4
  • 536
  • 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

... TCGCTAGAACACATTGACOMCA-F ATGATGAAACGGTTCAATOMCA-R TTAGTTACCGTGTGCTTCOMCB-F CTGCTGCTCGCAGCAAGTOMCB-R GTGTGATCTGCAACTGTTOMCA-PBAD-F CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R TTAGTTACCGTGTGCTTCOMCB-PBAD-F ... TTAGTTACCGTGTGCTTCOMCB-PBAD-F CACCGAGGAATAATAAATGATGAACGCACAAAAATCAOMCB-PBAD-R TTACATTTTCACTTTAGTShewanella oneidensis MR-1 OmcA and OmcB kinetics J. Borloo et al.3736 FEBS Journal 274 (2007) 3728–3738 ª 2007 The ... used as a positive control to display omcA(lane 1) and omcB (lane 6). DNA standards are indicated at the leftand right of the agarose gels. (B) Visualization and separation of high molecular mass...
  • 11
  • 731
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Part-of-Speech Induction from Text" pdf

... errors have a strong negative effect on the results of the vector comparisons. Fortunately, the problem of data sparseness can be minimized by reducing the dimensionality of the matrix. An appropriate ... appropriate alge-braic method that has the capability to reduce the dimensionality of a rectangular matrix is Singular Value Decomposition (SVD). It has the property that when reducing the number ... to their secondary class than unambiguous words. Having obtained the three expected clusters, the next investigation concerns the assignment of the ambiguous words to additional clusters. As...
  • 4
  • 433
  • 0

Xem thêm

Từ khóa: effect of the thinning of the ozone layer on human healthtelling the tale of the rise of the novelnarrative of the execution of the queen of scotsdescribe the cause of the war of the spanish successionwhat is the role of the president of the uk supreme courtthe war of the end of the world book reviewBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ