Báo cáo sinh học: " A simulation study of the effect of connectedness on genetic trend" potx
... only a limited picture of the effect of connectedness. The analytical study of the effect of connectedness on response to selection requires the calculation of selection ... that subpopulations are large enough. The lack of connection induces a large bias in the estimation of the genetic level of the subpopulations, becau...
Ngày tải lên: 09/08/2014, 18:22
... and implementation of the training programme and evalua- tion of the long term benefits to particular target groups and the social system at large. Basing an impact evaluation framework on the strength of ... may notbeabletoprovidethecasualrelationsamongvari- ables leading to an impact, it could establish a ‘plaus ible association’ whereby a ‘reasonable person , knowing wh...
Ngày tải lên: 18/06/2014, 17:20
... data, performed data analysis, did the visual evaluation of all dot plots and wrote parts of the manuscript. LP coordinated the collection and assembly of data, did all statistical analysis and ... a large fraction of representative proto- cols the addition of a DUMP channel to a dead cell dye mayhavefavourableeffects.Inasmallfraction(1 5of 100) of paired replicates...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo y học: "A case study evaluating the use of clozapine in depression with psychotic feature" docx
... effects. There was no standardisation of treatment given prior to clozapine administration. There was no comparison group or long term follow up of patients. Banov MD, Zarate CA Jr, Tohen M, Scialabba ... chlorpromazine and olanzap- ine medication were stopped and she was started on haloperidol and amitriptyline. Two days later, she started experiencing second person auditory halluci...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo sinh học: "A case study of the College English Test and ethnic minority university students in China: negotiating the final hurdle" pptx
... Instead of a certificate, students who scoreabove220areawardedatranscriptissuedbytheNationalCET-4andCET-6 Commission on behalf of the Department of Higher Education of the National Minis- try of Education ... Xia is an Associate Professor in the School of Foreign Languages for International Business at the Shanghai Institute of Foreign Trade, and a doctoral student...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " A comparative study of some methods for color medical images segmentation" pdf
... segmentation the error measures are calculated in relation with manual segmentation. The GCE and LCE demonstrate that the image segmentation based on an HS produces a better segmentation than the back-projection ... them are well known: the color set back-projection algorithm and the local variation algorithm. The 8 A feature space is the range space of any function o...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: "A reduced animal model with elimination of quantitative trait loci equations for marker-assisted selection" pdf
... animals which have the marker data or provide relationship ties among descendant animals with known marker data. An appropriate covariance matrix of the residual effects ... to the sire and the dam of animal i, and G, is a block diagonal matrix (Saito and Iwaisaki, 1996) in which each block is calculated as where fi is the conditio...
Ngày tải lên: 09/08/2014, 18:22
Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc
... practical purposes, we can not claim that our algorithm is capable of finding all the fine grained distinctions that are listed in manually created dictionaries such as the Longman Dictionary ... of speech of the context words are considered. By op- erating on a part -of- speech tagged corpus those sense distinctions that have an effect on part of speech can be ta...
Ngày tải lên: 20/02/2014, 16:20
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... TCGCTAGAACACATTGAC OMCA-F ATGATGAAACGGTTCAAT OMCA-R TTAGTTACCGTGTGCTTC OMCB-F CTGCTGCTCGCAGCAAGT OMCB-R GTGTGATCTGCAACTGTT OMCA-PBAD-F CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC OMCA-PBAD-R TTAGTTACCGTGTGCTTC OMCB-PBAD-F ... TTAGTTACCGTGTGCTTC OMCB-PBAD-F CACCGAGGAATAATAAATGATG AACGCACAAAAATCA OMCB-PBAD-R TTACATTTTCACTTTAGT Shewanella oneidensis MR-1 OmcA and OmcB kinetics J. Borloo et al. 3736 F...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Part-of-Speech Induction from Text" pdf
... errors have a strong negative effect on the results of the vector comparisons. Fortunately, the problem of data sparseness can be minimized by reducing the dimensionality of the matrix. An appropriate ... appropriate alge- braic method that has the capability to reduce the dimensionality of a rectangular matrix is Singular Value Decomposition (SVD). It has...
Ngày tải lên: 08/03/2014, 04:22