Báo cáo sinh học: "Expected efficiency of selection for growth in a French beef cattle breeding scheme II Prediction of asymptotic genetic gain in a heterogeneous population" docx
Báo cáo sinh học: "Expected efficiency of selection for growth in a French beef cattle breeding scheme. II. Prediction of asymptotic genetic gain in a heterogeneous population" docx
... 1-8 Original article Expected efficiency of selection for growth in a French beef cattle breeding scheme. II. Prediction of asymptotic genetic gain in a heterogeneous population F ... paper (Phocas et al, 1995). Derivation of annual genetic gain and genetic lags The asymptotic genetic gain in open populations is usually de...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo sinh học: " Expected efficiency of selection for growth in a French beef cattle breeding scheme. I. Multistage selection of bulls used in artificial insemination" docx
... deviations of differentials for Hs are in the range of uncertainty in maternal variance of W210. Standard deviations for selection differentials in Hg are in the range of ... scheme, standard deviations increase when progeny test capacity increases. More males are evaluated on maternal performance and thus the uncertainty in preweanin...
Ngày tải lên: 09/08/2014, 18:21
báo cáo sinh học:" Designing financial-incentive programmes for return of medical service in underserved areas: seven management functions" potx
... financial incentives for return of medical service in underserved areas: a health worker enters into a contract to practise for a number of years in an underserved area in exchange for a financial payoff. Table ... for the long-term success of financial-incentive programmes (Figure 1). First, pro- grammes need a sustainable source of financing to pay for the...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Contracting private sector providers for public sector health services in Jalisco, Mexico: perspectives of system actors" ppt
... an important increase Table 3: Basic health unit personnel reasons for characterizing the contracting mechanism as advantageous or disadvantageous Category Reasons Somewhat advantageous 1. Salary ... to the central coordinating offices in Guadalajara. Based on productivity reports, the coordinating office estimates the additional payment. Statistical records are maintained at the central...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Community-owned resource persons for malaria vector control: enabling factors and challenges in an operational programme in Dar es Salaam, United Republic of Tanzania" ppt
... Mayagaya V, Mtasiwa D, Mshinda H, Fillinger U, Lindsay SW, et al: Interdependence of domestic malaria prevention measures and mosquito-human interactions in urban Dar es Salaam, Tanzania. Malar ... Mtasiwa D, Kiama M, Lindsay SW, Fillinger U, Kannady K, Tanner M, Killeen GF: Community-based surveillance of malaria vector larval habitats: a baseline study in urban Dar es Salaam, Tanz...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " Cyclooxygenase activity is important for efficient replication of mouse hepatitis virus at an early stage of infection" ppt
... early stage of infection Matthijs Raaben 1 , Alexandra WC Einerhand 2 , Lucas JA Taminiau 2 , Michel van Houdt 2 , Janneke Bouma 2 , Rolien H Raatgeep 2 , Hans A Büller 2 , Cornelis AM de Haan 1 ... cultures. Data are presented as mean ± standard error of mean (n = 6). For statistical analysis a one-way ANOVA with the Tukey- Kramer test was performed using GraphPad Prism versio...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: "Fixed point-type results for a class of extended cyclic self-mappings under three general weak contractive conditions of rational type" potx
... Investigacion y Desarrollo de Procesos, Universidad del Pais Vasco, Campus of Leioa (Bizkaia) – Aptdo. 644-Bilbao, 48080-Bilbao, Spain 2 Department of Mathematics, Texas A& amp;M University - Kingsville, ... point-type results for a class of extended cyclic self-mappings under three general weak contractive conditions of rational type Manuel De la Sen *1 and Ravi P Agarwal 2...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " An advanced Bayesian model for the visual tracking of multiple interacting objects" pptx
... below). For information about publishing your research in EURASIP Journal on Advances in Signal Processing go to http://asp.eurasipjournals.com/authors/instructions/ For information about other SpringerOpen ... del Blanco, F Jaureguizar, N Garcia, Visual tracking of multiple interact- ing ob jects through Rao–Blackwellized data association particle filtering, in IEEE Proceedings o...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " The 3'''' sequences required for incorporation of an engineered ssRNA into the Reovirus genome" pot
... 150 CUA CGC CUG AAU AAG UGA UAA UAAGCGGAUGAAUGGCAGAAAUUCGGAUCCAAGAUCUC G AGACGCGAUGGUGUCAUGACCCAAGCUCAGCAG A AUCAAGUUGAAGCGUUGGCAGAUCAGACUCAACAGUUUAAGAGGACAAG C UCGAAACGUGGGCGAGAGAAGACGAUCAAUAUAAUCAGGCUCAUCCCAA C UCCACAAUGUUCCGUACGAAACCAUUUACGAAUGCGCAAU ... UAAGCGGAUGAAUGGCAGAAAUUCGGAUCCAAGAUCUC G AGACGCGAUGGUGUCAUGACCCAAGCUCAGCAG A AUCAAGUUGAAGCGUUGGCAGAUCAGACUCAACAGUUUAAGAGGACAAG C UC...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo sinh học: " Shell Vial culture Assay for the rapid diagnosis of Japanese encephalitis, West Nile and Dengue-2 viral encephalitis" pdf
... Pediatrics, Jawaharlal Institute of Post-graduate Medical Education and Research, Pondicherry – 605 006, India Email: Rangaiah S Jayakeerthi* - srjkeerthi@yahoo.com; Raghava V Potula - raghava@potula.net; ... Srinivasan 2 and S Badrinath 1 Address: 1 Department of Microbiology, Jawaharlal Institute of Post-graduate Medical Education and Research, Pondicherry – 605 006, India and 2 De...
Ngày tải lên: 19/06/2014, 08:20