Báo cáo khoa hoc:"Lack of congruence between morphometric evolution and genetic differentiation suggests a recent dispersal and local habitat adaptation of the Madeiran lizard Lacerta dugesii" doc
... Allozyme variation in populations of Lacerta raddei and Lacerta nairensis (Sauria: Lacertidae) from Armenia, Amphibia-Reptilia 17 (1996) 233– 246. [6] Cavalli-Sforza L., Edwards A. , Phylogenetic analysis: ... in lizards [19]. The Madeira Archipelago consists of Madeira and Porto Santo Islands plus two groups of smaller islands (Selvagens and Desertas). Distances between...
Ngày tải lên: 09/08/2014, 18:21
... degree of standardization, we used commercially available galac- tose instead of agitated saline. Statistical Analysis Continuous data are shown as mean and standard devia- tion (SD); categorical variables ... included only small numbers of patients and thus did not allow to adjust the analysis for gender and age. The aim of our study was to re-evaluate the association be...
Ngày tải lên: 11/08/2014, 07:20
... participated in designing the study, and performed statistical analysis. AB performed SNP testing, data organization, and analysis. MT partici- pated in designing the study and drafting of the manu- script. Acknowledgements We ... reported a lack of association between CT60 genotype and sCTLA-4 levels. On the other hand, our findings appear to be at odds with the spe...
Ngày tải lên: 11/08/2014, 07:20
Báo cáo khoa hoc:" Lack of association between mutations of gene-encoding mitochondrial D310 (displacement loop) mononucleotide repeat and oxidative stress in chronic dialysis patients in Taiwan" ppsx
... significant tissue pathology [15]. We pro- posed that chronic renal failure was not the result of just 1 type of mtDNA damage but rather the sum total of a large number of mtDNA mutations that accumulate ... to be associated with a change in the mtDNA copy number of these patients. Table 1: Characteristics of demographic, biochemistry, and oxidative stress marker varia...
Ngày tải lên: 11/08/2014, 07:21
Tài liệu Báo cáo khoa học: Basis of recognition between the NarJ chaperone and the N-terminus of the NarG subunit from Escherichia coli nitrate reductase pdf
... to investigate the kinetic parameters of the interaction (on rate constant k on and off rate constant k off ) between NarJ and the NarG(1–15) peptide. Taking into account the existence of two subpopulations ... 100 mM NaCl. The upper panels show the raw data for the heat effect during the titrations; the lower panels are the binding isotherms. Table 2. Thermodyna...
Ngày tải lên: 16/02/2014, 14:20
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
... Idem MAP2-for MAP2-rev GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC 91489–91517 92431–92404 NC_000067 Idem Tau-for Tau-rev GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC 78772–78800 79013–78981 NC_000077 Idem STOP-for STOP-rev AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG 210–237 657–631 NC_000073 ... Idem Doublecortin-for Doublecortin-rev CCCCAAACTTGT...
Ngày tải lên: 23/03/2014, 05:22
Báo cáo khoa học: "Lack of bioequivalence of two oxytetracycline formulations in the rabbit" doc
... pig and cow. Materials and methods Preparation of test materials. Two power preparations of OTC available were allocated one as the reference and the other as the test product. The amount of OTC ... initial absorption rate constant and 'b' is an apparent elimination rate constant. Parameters Y and Y 0 are measured and background plasma levels of oxytetrac...
Ngày tải lên: 07/08/2014, 15:20
Báo cáo khoa học: "Lack of mother tree alleles in zymograms of Cupressus dupreziana A. Camus embryos" ppsx
... be a unique case of “paternal apomixis”. The bio- logical significance and adaptive “benefits” of this unex- pected feature are not clear. It may be the expression of a trait of survival for a ... Pinaceae mitochondrial DNA is usually maternally inherited [9, 26]. But, to our knowledge, paternal inheritance of the whole nuclear DNA was never reported. 4.5. Androgenesis...
Ngày tải lên: 08/08/2014, 14:21
Báo cáo y học: "Lack of Correlation between Severity of Clinical Symptoms, Skin Test Reactivity, and Radioallergosorbent Test Results in Venom-Allergic Patients" pptx
... (> 17.5 kUA/L) Statistical Analysis Comparison of the three parameters (skin test, RAST, and clinical severity) was performed by Kruskal-Wallis one-way analysis of variance (ANOVA) on ranks, with ... Three-dimensional plot of skin test, RAST, and clinical severity scores of 36 patients with sting- ing-venom allergy (as a surface plot). 62 There is an understandable tendency...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Lack of association between glucocorticoid use and presence of the metabolic syndrome in patients with rheumatoid arthritis: a cross-sectional study" ppsx
... interests. Authors' contributions TET participated in the conception and design of the project and in the analysis and interpretation of data and contributed substantially to the drafting of the manuscript. ... contributed substantially to the conception and design of the project and to the revision of the draft of the manuscript. All authors r...
Ngày tải lên: 09/08/2014, 01:22