Procedural Abstraction and Functions That Return a Value

Procedural Abstraction and Functions That Return a Value

... Pearson Education, Inc. Publishing as Pearson Addison-WesleyChapter 4Procedural Abstraction and Functions That Return a Value Slide 4- 3Copyright © 2007 Pearson Education, Inc. Publishing as ... formal parameter namesFormal parameters are like placeholders for the actualarguments used when the function is calledFormal parameter names can be any valid identifierExample:double...

Ngày tải lên: 12/09/2012, 22:48

94 541 0

Using Local Variables and Creating Functions that Return Results

... < Day Day Up > Using Local Variables and Creating Functions that Return Results The variables you've created and used so far can be accessed at any time by any script in the Flash ... clip that has an instance name of cableBox_mc (and which looks like a cable box). This movie clip instance contains a simple graphic and a text field with an instance name...

Ngày tải lên: 07/11/2013, 15:15

10 327 0

Convex sets and convex functions taking the infinity value

... is a nonzero vector in IR n , and α is a scalar. (3) Open half-space : S = {x|p T x < α}, where p is a nonzero vector in IR n and α is a scalar. (4) Polyhedral set : S = {x|Ax ≤ b}, where A ... Optimization 20 / 108 Chapter 1 Convex sets and convex functions taking the inﬁnity value Inﬁmal Convolution Proposition. Let f 1 and f 2 be two proper convex functions. If th...

Ngày tải lên: 23/10/2013, 15:20

22 442 1

Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Puriﬁcation and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

... characterization Physiological and biochemical parameters, such as Gram reaction, ﬂagella type, catalase activity, oxidase activity and OF test, were determined using classical methods [15]. Alkali production of amides, ... proteins including those of extradiol dioxygenases available in the FASTA AND BLAST database programs at the DNA Data Bank of Japan. The gene encoding 4-amino-3-hydr...

Ngày tải lên: 21/02/2014, 01:21

7 490 0

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... 5¢-CTAGACTCGAGCCTAAT TTATATTTGCTCCTTGTGC-3¢. b-Actin primers were designed as follows: forward 5¢-CTACAATGAGCTGCG TGT-3¢ and reverse 5¢-AAGGAAGGCTGGAAGAGT-3 ¢. Cell survival and apoptosis analysis For viability ... caspases. Taken together, these results indicate that VBARP is a novel splice variant of ANKHD1 and may play a role in cellular apoptosis (antiapoptotic) and cell sur...

Ngày tải lên: 07/03/2014, 21:20

12 561 0

Báo cáo khoa học: Synthesis and characterization of Pi4, a scorpion toxin from Pandinus imperator that acts on K+ channels doc

... S5–H5–S6 domains. The quality of all molecular models was assessed using the programs WHAT IF [28] and PROCHECK [29]. In each case, the stereochemical quality and the Ramachandran [30] scores were good and ... S. M’Barek et al. (Eur. J. Biochem. 270) Ó FEBS 2003 Synthesis and characterization of Pi4, a scorpion toxin from Pandinus imperator that acts on K + channels Sarrah M’Barek...

Ngày tải lên: 17/03/2014, 10:20

10 503 0

Báo cáo Y học: A Ca2+/CaM-dependent kinase from pea is stress regulated and in vitro phosphorylates a protein that binds to AtCaM5 promoter ppt

... 5¢-AAACCAGCCATGAATGAAAT-3¢) and with actin primers (forward primer: 5¢-GTTGGGAT GAACCAGAAGGA-3¢; reverse primer: 5¢-GAACCA CCGATCCAGACACT-3¢) as a control. Reactions with no DNA added served as a ... promoter fragment. The sequences of the oligonucleotides used for these experiments are: Oligo I, 5¢-CAAGGACGTTCGATGCA CTTCCAAAAAACATATAAT-3¢; Oligo II, 5¢-CAAT GTAGTATTAAAAAGTAGTAGTTAAAA...

Ngày tải lên: 18/03/2014, 01:20

12 365 0

Báo cáo khoa học: A strategy for the generation of speciﬁc human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA JH1-2.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC JH3.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC JH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC JH6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC VK6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGG...

Ngày tải lên: 23/03/2014, 13:20

11 680 0

Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

... Saminathan M, Antony T, Shirahata A, Sigal LH, Thomas T & Thomas TJ (1999) Ionic and structural speciﬁcity effects of natural and synthetic polyamines on the aggregation and resolubilization ... 3787 Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation Luciano D’Agostino 1 , Massimiliano di Pietro 1...

Ngày tải lên: 23/03/2014, 15:20

11 380 0

Báo cáo khoa học: Sugar and alcohol molecules provide a therapeutic strategy for the serpinopathies that cause dementia and cirrhosis pot

... neuroserpin migrated as a single band on SDS ⁄ PAGE and > 90% was in a mono- meric form when assessed by nondenaturing and transverse urea gradient PAGE [56]. Puriﬁcation of Z a 1 -antitrypsin and refolding/incubation ... the Z, Siiyama and Mmalton variants of a 1 -antitrypsin. Hepatology 40, 1203–1210. 26 An JK, Blomenkamp K, Lindblad D & Teckman JH (2005) Quantitative...

Ngày tải lên: 30/03/2014, 11:20

13 494 0