346 Biomass – Detection, Production and Usage live yeast biomass for the leavening of bread docx

Báo cáo y học: "Thioglycosides as inhibitors of hSGLT1 and hSGLT2: Potential therapeutic agents for the control of hyperglycemia in diabetes"

Báo cáo y học: "Thioglycosides as inhibitors of hSGLT1 and hSGLT2: Potential therapeutic agents for the control of hyperglycemia in diabetes"

... β-glucosidases in the intestine and can be adminis- tered orally [27]. Therefore, the aim of the present study was to evaluate the inhibitory effect of some thioglycosides synthesized in our ... Paper Thioglycosides as inhibitors of hSGLT1 and hSGLT2: Potential therapeutic agents for the control of hyperglycemia in diabetes Francisco Castan...

Ngày tải lên: 26/10/2012, 10:04

9 651 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

... article, a conceptual framework is proposed for the management of public health and social issue behaviors. The article relies on education, marketing, and law as its three primary classes of strategic ... can consider variables relevant to the selection of education, marketing, and law as sets of tools that can be brought to bear on the management...

Ngày tải lên: 18/02/2014, 02:20

14 780 0
The importance of project management in small- and medium-sized enterprises (SMEs) for the development of new products through E-collaboration docx

The importance of project management in small- and medium-sized enterprises (SMEs) for the development of new products through E-collaboration docx

... the progression to reduce time and cost in developing new products in SMEs. To understand the importance of coordinating these sections with the project manager and validated the model, the ... development by the project manager through e- collaboration. Project management process All projects have a beginning and an ending, and project...

Ngày tải lên: 07/03/2014, 00:20

12 982 0
Báo cáo khoa học: Re-evaluation of intramolecular long-range electron transfer between tyrosine and tryptophan in lysozymes Evidence for the participation of other residues doc

Báo cáo khoa học: Re-evaluation of intramolecular long-range electron transfer between tyrosine and tryptophan in lysozymes Evidence for the participation of other residues doc

... Re-evaluation of intramolecular long-range electron transfer between tyrosine and tryptophan in lysozymes Evidence for the participation of other residues Marilyne Stuart-Audette 1 , ... technique. The bityrosine signal was observed in all peptides containing tyrosine 23 or 53 but not in peptides containing tyrosine 20 alone. According to these...

Ngày tải lên: 17/03/2014, 10:20

7 475 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

... PCR primers Sequence Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 Type-specific ... Open Access A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA Wang Yu-Hong 1† , Chen Rui 2† and...

Ngày tải lên: 21/06/2014, 01:20

9 469 0
Báo cáo khoa học nông nghiệp " Using FFS to enhance farmers'''' knowledge and skills in citrus production management in the process of implementing GAP in the South of Vietnam " docx

Báo cáo khoa học nông nghiệp " Using FFS to enhance farmers'''' knowledge and skills in citrus production management in the process of implementing GAP in the South of Vietnam " docx

... research so the input of Australian staff in the actual training program of TOT was minimal and did not warrant inclusion in the cost of the training. GAP Workshop in Binh Thuan (21-22/7/2008) ... days and seminars are the best way of communicating new knowledge to farmers with 46.1% farmers nominating these methods in the MD and 54.9 % in...

Ngày tải lên: 21/06/2014, 05:20

13 523 0
Báo cáo khoa học nông nghiệp " The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - MS2 " potx

Báo cáo khoa học nông nghiệp " The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - MS2 " potx

... improvement and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam (009/05VIE) in Vietnam during the period ... The development and implementation of new appropriate technologies for improving goat production and increasing sm...

Ngày tải lên: 21/06/2014, 06:20

12 542 0
Project Progress Report: The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - MS3 " doc

Project Progress Report: The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - MS3 " doc

... initiation of activities for the CARD project The improvement and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region ... observed in the system. 13 1. Institute Information Project Name The development and implementation of new appropriate...

Ngày tải lên: 21/06/2014, 06:20

13 659 0
The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - Milestone 9" pot

The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region of Vietnam - Milestone 9" pot

... Rural Development Project Progress Report The development and implementation of new appropriate technologies for improving goat production and increasing small-holder income in the central region ... improving goat production and increasing small-holder income in the central region of Vietnam . This is a program which incl...

Ngày tải lên: 21/06/2014, 06:20

9 377 0
Báo cáo hóa học: " Research Article Neural Mechanisms of Motion Detection, Integration, and Segregation: From Biology to Artificial Image Processing Systems" docx

Báo cáo hóa học: " Research Article Neural Mechanisms of Motion Detection, Integration, and Segregation: From Biology to Artificial Image Processing Systems" docx

... on Advances in Signal Processing 6. Summary and Conclusion We presented a model of motion processing in areas V1 and MT capable of handling synthetic as well as artificial image sequences. The ... modelling of neural mechanisms (functionality) and their interaction is motivated by prin- ciple findings of electrophysiology, anatomical studies, and theories of info...

Ngày tải lên: 21/06/2014, 09:20

22 231 0
Báo cáo hóa học: " Research Article Development of Long-Range and High-Speed Wireless LAN for the Transmission of Telemedicine from Disaster Areas" pdf

Báo cáo hóa học: " Research Article Development of Long-Range and High-Speed Wireless LAN for the Transmission of Telemedicine from Disaster Areas" pdf

... Journal on Wireless Communications and Networking Volume 2008, Article ID 724010, 13 pages doi:10.1155/2008/724010 Research Article Development of Long-Range and High-Speed Wireless LAN for the Transmission ... City, Nagano). The wireless networks made up of these wireless LAN units are shown in Figure 5. The wireless LAN in 2.4 GHz band should be...

Ngày tải lên: 22/06/2014, 06:20

13 319 0
BIOMASS – DETECTION, PRODUCTION AND USAGE pdf

BIOMASS – DETECTION, PRODUCTION AND USAGE pdf

... existing and potential biomass usage pathways is critical for charting the way forward at the global scale, and in different regions. Biomass – Detection, Production and Usage 16 estimation ... tree height estimation, crown size estimation for volume and biomass estimation of different forest Biomass – Detection, Production and Usage 24 Moorthy,...

Ngày tải lên: 29/06/2014, 16:20

508 393 0
346 Biomass – Detection, Production and Usage live yeast biomass for the leavening of bread docx

346 Biomass – Detection, Production and Usage live yeast biomass for the leavening of bread docx

... glycerol, mixtures of dextrose and xylose, xylose Production of Enriched Biomass by Carotenogenic Yeasts - Application of Whole-Cell Yeast Biomass to Production of Pigments and Other Lipid Compounds ... cells (6 3–7 4%) and the fibrillar part of cell wall ( 2–2 2%), whereas exopolymers bound only 1 2–3 2% of the total sorbed amount. The yeasts with h...

Ngày tải lên: 09/08/2014, 16:21

51 394 0
IDENTIFICATION OF A MINIMAL CIS-ELEMENT AND COGNATE TRANS-FACTORS REQUIRED FOR THE REGULATION OF RAC2 GENE EXPRESSION DURING K562 CELL DIFFERENTIATION

IDENTIFICATION OF A MINIMAL CIS-ELEMENT AND COGNATE TRANS-FACTORS REQUIRED FOR THE REGULATION OF RAC2 GENE EXPRESSION DURING K562 CELL DIFFERENTIATION

... upstream or downstream of a gene, within a gene, or thousands of base pairs away from the start site of the gene. Enhancers contain binding sites for transcription factors that communicate with the ... Aurora/AIK family, Aurora -A and Aurora-B, have been identified as the histone H3 kinase (Crosio, Fimia et al. 2002). A balance of protein phosphatase and ki...

Ngày tải lên: 24/08/2014, 12:22

144 242 0
design, synthesis, and biological evaluation of new anti-cancer nitrogen-containing combretastatins and novel cysteine protease inhibitors for the treatment of chagas

design, synthesis, and biological evaluation of new anti-cancer nitrogen-containing combretastatins and novel cysteine protease inhibitors for the treatment of chagas

... Evaluation of New Anti-cancer Nitrogen-Containing Combretastatins and Novel Cysteine Protease Inhibitors for the Treatment of Chagas Rogelio Siles Mentor: Kevin G. Pinney, Ph.D. In an effort ... Six: Synthesis, Design and Biochemical Evaluation of Cysteine Protease Inhibitors: Novel Compounds for Chagas Disease Treatment 143...

Ngày tải lên: 14/11/2014, 11:32

516 254 0
Từ khóa:
w