Báo cáo y học: "Hyperuricemia and cardiovascular disease: how strong is the evidence for a causal link" docx

... 1 Theories on the causal association between hyperuricemia and selected cardiovascular diseases. Simple causal diagrams on the association between hyperuricemia and selected cardiovascular diseases. ... women after adjustment for cardiovascular risk factors and diuretic use. These results raised the question of an association of serum urate with cardiovascular diseas...

Ngày tải lên: 09/08/2014, 14:22

... controlled trials (RCTs) that are theoretically and methodologically consistent across studies, Bloom has suggested meta-analytic strategies to take advantage of naturally-occurring variations in ... include providing a consistent and generalisable framework within which to gather evidence; promoting the under- standing of causal mechanisms that both enrich theory and facilitate...

Ngày tải lên: 11/08/2014, 05:21

... Tsunami in Thailand and Indonesia [27,43], the Chi-Chi earthquake in Taiwan [16,39] and the Gujarat earthquake in India [44]. As demonstrated, the army plays an important part in the early response ... evacuated mainly by air. It was the air force’s responsibility, along with the air transport organization, to provide the evacuation by air. In addition they carried managers,...

Ngày tải lên: 25/10/2012, 09:56

... fetal hepatocytes and the presence of an active and inactive form of the BCATm in fetal and adult liver, respectively. MATERIALS AND METHODS Fetal livers Wistar rats of 17- and 19-days gestation ... [9,12]. Isolation of total RNA and Northern blot analysis Total RNA was isolated from liver, heart, or placenta according to Chomczynski and Sacchi [15]. For Northern analysis,...

Ngày tải lên: 31/03/2014, 23:20

... 5'-GTT- TACTTTGGTGCCAGG (antisense) and 5'- GCTTGAAACATAGGAGCTG (sense) (OPG), 5'-GGGTAT- GAGAACTTGGGATT (antisense) and 5'-CACTATTAAT- GCCACCGAC (sense) (RANKL), and 5'- CAGAACATCATCCCTGCCTCT ... participated in study design, analysis and interpretation of data, manuscript preparation, and statistical analysis. SKT participated in study design, acquisition...

Ngày tải lên: 09/08/2014, 10:21

... glycolysis, tricarboxylic acid cycle, glyoxylate cycle, pentose phosphate shunt, and synthesis of all 20 standard a mino acids and the five nucleic acid bases. Moreover, dermatophytes appear ... (Eurotiales), Coccidioides and Histo- plasma (Onygenales) the mating type (MAT) loci are flanked by APN2 and the SLA2 genes encoding a DNA lyase and a cytoskeleton protein, respe...

Ngày tải lên: 09/08/2014, 22:23

... transition sepa- rately, and peak areas were manually tabulated Statistical analysis HPLC data obtained from the preformulation studies were expressed as the average percentage of the peak area ... Day and Dr. Manimalha Balasubramani at the Genomics and Proteomics Core Laboratories at the University of Pittsburgh for the assistance provided for the MALDI-TOF MS analysi...

Ngày tải lên: 10/08/2014, 05:22

... helper type 1 cells contribute to the perpetuation of disease. However, there is no guarantee that the mechanisms of late disease are identical to very early rheumatoid arthritis. Evaluation of the ... to the resolution. In this context, the study by Raza and colleagues raises questions about the role of T cells in RA and other forms of inflammatory arthritis. Many studies h...

Ngày tải lên: 09/08/2014, 06:23

... activity and provide a cautionary tale for genetically uncontrolled studies. Background The epidermal growth factor receptor (EGFR) pathway plays key roles in the development and maintenance of many ... Homozygous Egfr wa2 mutant and wildtype littermates were evaluated for defects in locomotor and masking behaviors. Results: Mice homozygous for Egfr wa2 showed normal dai...

Ngày tải lên: 10/08/2014, 09:20

... [http://nhg.artsennet.nl/kenniscentrum/ k_richtlijnen/k_nhgstandaarden/Samenvattingskaartje-NHGStandaard/ M01_svk.htm]. 17. Garrow AP, Papageorgiou AC, Silman AJ, Thomas E, Jayson MI, Macfarlane GJ: Development and validation of a questionnaire to assess disabling ... their assessment, and whether adequate deci- sions are made regarding treatment. For this evaluation, the notes of...

Ngày tải lên: 10/08/2014, 21:24