Báo cáo y học: "Atherosclerotic disease is increased in recent-onset rheumatoid arthritis: a critical role for inflammation" ppsx

Báo cáo y học: "Atherosclerotic disease is increased in recent-onset rheumatoid arthritis: a critical role for inflammation" ppsx

Báo cáo y học: "Atherosclerotic disease is increased in recent-onset rheumatoid arthritis: a critical role for inflammation" ppsx

... arthritis inflammatory activityCoassociation of carotid intima media thickness, age and rheumatoid arthritis inflammatory activity. The carotid intima media thickness (cIMT) was measured in 37 rheumatoid ... not for citation purposes) Vol 9 No 6 Research article Atherosclerotic disease is increased in recent-onset rheumatoid arthritis: a critical role for inflam...

Ngày tải lên: 09/08/2014, 10:21

9 347 0
Báo cáo y học: "Association of the FCRL3 gene with rheumatoid arthritis: a further example of population specificity" ppsx

Báo cáo y học: "Association of the FCRL3 gene with rheumatoid arthritis: a further example of population specificity" ppsx

... been widely repli- cated (summarised in [2]). Interestingly, this disease causal polymorphism is not present in the Japanese population, and haplotype analysis of other polymorphisms mapping to ... was tested. Genotyping was performed using either the Sequenom MassArray iPlex platform or a 5' Allelic discrimination assay (Taqman, ABI). Extensive linkage disequilibrium was prese...

Ngày tải lên: 09/08/2014, 08:22

5 407 0
 Báo cáo y học: " Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphis"

Báo cáo y học: " Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphis"

... 2001;413(6853):316-22. 4. Yada M, Hatakeyama S, Kamura T, Nishiyama M, Tsunematsu R, Imaki H, Ishida N, Okumura F, Nakayama K, Nakayama KI. Phosphorylation-dependent degradation of c-Myc is mediated by the F-box ... Tsunematsu R, Nakayama K, Oike Y, Nishiyama M, Ishida N, Hatakeyama S, Bessho Y, Kageyama R, Suda T, Nakayama KI. Mouse Fbw7/Sel-10/Cdc4 is required for notch degra...

Ngày tải lên: 31/10/2012, 16:49

4 393 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

... 5¢-CCGTT TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢. C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢.C-213S:5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢. C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢. ... H24 4A: 5¢-CAAAGAAGCAGATCATAT GGGAATGCTTTCGCAGCCAAGGG-3¢. D21 6A: 5¢-G CGAGCTTATATCTTTTGCAATGAAGATAAATCAT TTCCAGTTGAG-3¢ All of the primers were 5¢-phosphorylate...

Ngày tải lên: 24/03/2014, 04:21

8 345 0
Báo cáo y học: "Galvanising mental health research in low- and middle-income countries: Role of scientific journals." docx

Báo cáo y học: "Galvanising mental health research in low- and middle-income countries: Role of scientific journals." docx

... (Shekhar Saxena, Pratap Sharan, Benedetto Saraceno, Barbara Aronson, Vladimir Poznyak, Izthak Levav, Edith Certain, R Srinivasa Murthy, Tikki Pang). Shekhar Saxena, Pratap Sharan, Hooman Momen and Benedetto ... Gueye), Quarterly Journal of Pakistan Psychiatric Society (Amin A. Gadit), Revista Brasileria de Psiquiatria (Jair Mari), Salud Mental (Hector Perez-Rincon), Social Psychiatry and Ps...

Ngày tải lên: 08/08/2014, 20:23

4 353 0
Báo cáo y học: "ECT associated musical hallucinations in an elderly patient: a case report" pps

Báo cáo y học: "ECT associated musical hallucinations in an elderly patient: a case report" pps

... hallu- cinations [2,3]. Musical hallucinations are pseudo hallucinations that originate in memory representations and they may undergo a transition to true hallucination. In musical hal- lucination ... report Raguraman Janakiraman* 1 , Keith Wildgoose 2 and Kalyan Seelam 1 Address: 1 Department of Psychiatry, Sheffield Care Trust, S5 7JT, UK and 2 Department of Psychiatry, Doncaster...

Ngày tải lên: 08/08/2014, 21:20

3 340 0
Báo cáo y học: "MMP-3 expression and release by rheumatoid arthritis fibroblast-like synoviocytes induced with a bacterial ligand of integrin α5β" pdf

Báo cáo y học: "MMP-3 expression and release by rheumatoid arthritis fibroblast-like synoviocytes induced with a bacterial ligand of integrin α5β" pdf

... syno- vial tissue of patients with advanced rheumatoid arthritis or osteoarthritis: analysis with gas chromatography-mass spec- trometry and pan-bacterial polymerase chain reaction. Arthritis Rheum 2003, ... probably play a role in transforming FLSs into inflammatory matrix-degrading cells. As bacterial products have been detected in the joint and shown to trigger joint inflammation...

Ngày tải lên: 09/08/2014, 06:22

9 395 0
Báo cáo y học: "4-Hydroxynonenal induces apoptosis in human osteoarthritic chondrocytes: the protective role of glutathione-S-transferase" doc

Báo cáo y học: "4-Hydroxynonenal induces apoptosis in human osteoarthritic chondrocytes: the protective role of glutathione-S-transferase" doc

... M, Akhand AA, Hayakawa A, Suzuki H, Miyata T, Kurokawa K, Hotta Y, Ishikawa N, Nakashima I: 4-hydroxynonenal induces a cellular redox status-related activation of the cas- pase cascade for apoptotic ... 45:12253-12264. 30. Awasthi YC, Sharma R, Sharma A, Yadav S, Singhal SS, Chaudary P, Awasthi S: Self-regulatory role of 4-hydroxynonenal in sign- aling for stress-induced programm...

Ngày tải lên: 09/08/2014, 13:21

11 395 0
Báo cáo y học: "An important step towards completing the rheumatoid arthritis cycle" pptx

Báo cáo y học: "An important step towards completing the rheumatoid arthritis cycle" pptx

... (the rheumatoid arthritis cycle) for the development and chronic nature of this disease. Rheumatoid arthritis (RA) is a chronic, progressive, inflam- matory autoimmune disease characterized by the ... apoptotic cells may become necrotic. Granulocytes and monocytes, and macrophages emerging from monocyte differentiation, contain citrullinating peptidylarginine deiminase (PAD) enzy...

Ngày tải lên: 09/08/2014, 13:21

3 283 0
Báo cáo y học: "Genome-wide association studies in systemic lupus erythematosus: a perspective" docx

Báo cáo y học: "Genome-wide association studies in systemic lupus erythematosus: a perspective" docx

... be a combination of the individual risks for each susceptibility allele in that gene. Further complexity arises because not only do particular individuals carry different combinations of risk alleles, ... genotyping chips do not carry every susceptibility allele for a given locus. Interpretation of whether a particular locus is associated with disease may, therefore, depend on...

Ngày tải lên: 09/08/2014, 14:22

2 222 0
w