Báo cáo y học: "Atherosclerotic disease is increased in recent-onset rheumatoid arthritis: a critical role for inflammation" ppsx
Báo cáo y học: "Atherosclerotic disease is increased in recent-onset rheumatoid arthritis: a critical role for inflammation" ppsx
... arthritis inflammatory activityCoassociation of carotid intima media thickness, age and rheumatoid arthritis inflammatory activity. The carotid intima media thickness (cIMT) was
measured in 37 rheumatoid ... not for citation purposes)
Vol 9 No 6
Research article
Atherosclerotic disease is increased in recent-onset rheumatoid
arthritis: a critical role for inflam...
Báo cáo y học: "Association of the FCRL3 gene with rheumatoid arthritis: a further example of population specificity" ppsx
... been widely repli-
cated (summarised in [2]). Interestingly, this disease causal
polymorphism is not present in the Japanese population, and
haplotype analysis of other polymorphisms mapping to ... was tested. Genotyping was performed using either the
Sequenom MassArray iPlex platform or a 5' Allelic discrimination
assay (Taqman, ABI). Extensive linkage disequilibrium was
prese...
Báo cáo y học: " Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphis"
...
2001;413(6853):316-22.
4. Yada M, Hatakeyama S, Kamura T, Nishiyama M, Tsunematsu
R, Imaki H, Ishida N, Okumura F, Nakayama K, Nakayama KI.
Phosphorylation-dependent degradation of c-Myc is mediated
by the F-box ... Tsunematsu R, Nakayama K, Oike Y, Nishiyama M, Ishida N,
Hatakeyama S, Bessho Y, Kageyama R, Suda T, Nakayama KI.
Mouse Fbw7/Sel-10/Cdc4 is required for notch degra...
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt
... 5¢-CCGTT
TGAGAAGTACAATGAGAAGTGTCCGGCAGATA
TG-3¢. C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT
GCTCAGTCGAGGACCTTG-3¢.C-213S:5¢-CGGTGA
AGCGAGCTTATATCTTTTGCAATGAAGATAAAT
CATTT-CC-3¢. C25 7A: 5¢GCCAAGGGAAGTTTGCA
AGTGCCTGCTTGATATATCAGATT-CA-3¢. ... H24 4A: 5¢-CAAAGAAGCAGATCATAT
GGGAATGCTTTCGCAGCCAAGGG-3¢. D21 6A: 5¢-G
CGAGCTTATATCTTTTGCAATGAAGATAAATCAT
TTCCAGTTGAG-3¢
All of the primers were 5¢-phosphorylate...
Báo cáo y học: "Galvanising mental health research in low- and middle-income countries: Role of scientific journals." docx
... (Shekhar Saxena, Pratap Sharan, Benedetto Saraceno,
Barbara Aronson, Vladimir Poznyak, Izthak Levav, Edith
Certain, R Srinivasa Murthy, Tikki Pang).
Shekhar Saxena, Pratap Sharan, Hooman Momen and
Benedetto ... Gueye),
Quarterly Journal of Pakistan Psychiatric Society (Amin A.
Gadit), Revista Brasileria de Psiquiatria (Jair Mari), Salud
Mental (Hector Perez-Rincon), Social Psychiatry and Ps...
Báo cáo y học: "ECT associated musical hallucinations in an elderly patient: a case report" pps
... hallu-
cinations [2,3].
Musical hallucinations are pseudo hallucinations that
originate in memory representations and they may
undergo a transition to true hallucination. In musical hal-
lucination ...
report
Raguraman Janakiraman*
1
, Keith Wildgoose
2
and Kalyan Seelam
1
Address:
1
Department of Psychiatry, Sheffield Care Trust, S5 7JT, UK and
2
Department of Psychiatry, Doncaster...
Báo cáo y học: "MMP-3 expression and release by rheumatoid arthritis fibroblast-like synoviocytes induced with a bacterial ligand of integrin α5β" pdf
... syno-
vial tissue of patients with advanced rheumatoid arthritis or
osteoarthritis: analysis with gas chromatography-mass spec-
trometry and pan-bacterial polymerase chain reaction. Arthritis
Rheum 2003, ... probably play a role in
transforming FLSs into inflammatory matrix-degrading cells. As
bacterial products have been detected in the joint and shown to
trigger joint inflammation...
Báo cáo y học: "4-Hydroxynonenal induces apoptosis in human osteoarthritic chondrocytes: the protective role of glutathione-S-transferase" doc
... M, Akhand AA, Hayakawa A, Suzuki H, Miyata T,
Kurokawa K, Hotta Y, Ishikawa N, Nakashima I: 4-hydroxynonenal
induces a cellular redox status-related activation of the cas-
pase cascade for apoptotic ... 45:12253-12264.
30. Awasthi YC, Sharma R, Sharma A, Yadav S, Singhal SS, Chaudary
P, Awasthi S: Self-regulatory role of 4-hydroxynonenal in sign-
aling for stress-induced programm...
Báo cáo y học: "An important step towards completing the rheumatoid arthritis cycle" pptx
... (the rheumatoid arthritis
cycle) for the development and chronic nature of this disease.
Rheumatoid arthritis (RA) is a chronic, progressive, inflam-
matory autoimmune disease characterized by the ... apoptotic
cells may become necrotic. Granulocytes and monocytes,
and macrophages emerging from monocyte differentiation,
contain citrullinating peptidylarginine deiminase (PAD)
enzy...
Báo cáo y học: "Genome-wide association studies in systemic lupus erythematosus: a perspective" docx
... be a combination of the individual
risks for each susceptibility allele in that gene. Further
complexity arises because not only do particular individuals
carry different combinations of risk alleles, ... genotyping
chips do not carry every susceptibility allele for a given locus.
Interpretation of whether a particular locus is associated with
disease may, therefore, depend on...