Báo cáo khoa học: " A prospective study of differences in duodenum compared to remaining small bowel motion between radiation treatments: Implications for radiation dose escalation in carcinoma of the pancreas" doc
Báo cáo khoa học: " A prospective study of differences in duodenum compared to remaining small bowel motion between radiation treatments: Implications for radiation dose escalation in carcinoma of the pancreas" doc
... available
AAPM/RTOG treatment planning format into a MATLAB
cell-array data object, facilitating manipulation; (2) view-
ers which display axial, coronal, and sagittal computed
tomography images, ... non-duodenal small bowel.
Specifically, the duodenum was contoured from the
pylorus to its ascending (fourth) portion, lateral to the
head of the pancreas. All remaining...
báo cáo hóa học: " A prospective study of decline in lung function in relation to welding emissions" pdf
... mg/dl).
Statistical analysis
We analyzed the data by two different approaches. In the
first approach we used the absolute measured values of
lung function to examine the change in FEV
1
and FVC
across ... smoking habits may explain
the apparent inconsistency. Our data are similar to the
findings of Beckett et al [10]. They found an annual
decline in FEV
1
among wel...
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx
... first investigate all of
our estimators on two re-ranking tasks: a parse
selection task and a language model adaptation task.
Then we apply the best of these estimators to two
additional tasks ... consider, parsing and lan-
guage model adaptation are both examples of
re-ranking. In these tasks, we assume that we have
been given a list of candidates () for each...
Báo cáo khoa học: A kinetic study of sugarcane sucrose synthase pdf
... and can have both
explanatory and predictive value.
Several papers that give a n overview of different approa-
ches for studying and modelling metabolism, such as
metabolic flux analysis, metabolic ... potential target steps for metabolic engineering,
because the reactions in the pathway that have the most
potential of modifying a target flux or metabolite c oncen-
tration c...
Báo cáo khoa học: "A Pilot Study of Opinion Summarization in Conversations" docx
... appears in a dialogue
of topic t, and p(w) is the probability of w ap-
pearing in a dialogue of any topic. Since our
goal is to rank DAs in the same dialog, and
the topic is the same for all the DAs, ... Answer-
ing the call for a standard reliability measure for cod-
ing data. Journal of Communication Methods and
Measures, 1:77–89.
Minqing Hu and Bing...
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot
... Takezawa, E. Sumita, F. Sugaya, H. Yamamoto,
and S. Yamamoto. 2002. Toward a broad-coverage
bilingual corpus for speech translation of travel
conversations in the real world. In Proceeding of ...
LREC-2002, Las Palmas de Gran Canaria, Spain.
D. Xiong, Q. Liu and S. Lin. 2006. Maximum Entro-
py Based Phrase Reordering Model for Statistical
Machine Translation. In Procee...
Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf
... goals. The DM
may also take into account contextual information
22
Figure 1: Example architecture of an ADS.
or historical data before making a decision. After
the system has decided what to say, ... varying and
available action density values. At each run, each
algorithm was evaluated using the same transition
probabilities and available actions. To assess how
the algorithm...
Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx
... and
bloodstream parasites results in a complete glyoxalase
system.
Implications for parasite chemotherapy
Mammalian cells maintain a repertoire of four path-
ways for metabolism of methylglyoxal [33], ... 1-X8 resin
(bicarbonate form) to raise the pH to 6.5. After stirring for
a further 2–3 h, the resin was again filtered, and the filtrate
was adjusted to pH 4.0...
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot
... ATATAT
CATATGTCCGGTGTCGCAAAG
R-TryX ATATA
GGATCCTTACTCGTCTCTCCACGG
F-TryP1 ATATAT
CATATGTCCTGCGGTAACGCC
R-TryP1 ATATA
GGATCCTTACTGCTTGCTGAAGTATC
F-TDPX1 Cys35Ala CAACGTAGCCAGCAAG
GCCGGCTTCACCAAGGGCG
R-TDPX1 Cys35Ala ... codons of the mutated amino acids are in bold.
Cloned protein or mutation primer (5’- to 3’)
F-TDPX1 TATAT
CATATGTCTATCTACGACTTCAAGGTC
R-TDPX1 ATATA
GGATCCTCACGATTGAGT...
Báo cáo khoa học: A spectroscopic study of the interaction of isoflavones with human serum albumin pdf
... interaction are available at the binding site
of HSA in order to accommodate genistein in addition
to accommodating warfarin. Results obtained from the
interaction of genistein and warfarin to HSA ... alongside
warfarin to HSA.
Binding of genistein in the presence of daidzein
The fluorescence of daidzein was found to increase on
binding to HSA as mentioned e...