Báo cáo khoa học: " A prospective study of differences in duodenum compared to remaining small bowel motion between radiation treatments: Implications for radiation dose escalation in carcinoma of the pancreas" doc

Báo cáo khoa học: " A prospective study of differences in duodenum compared to remaining small bowel motion between radiation treatments: Implications for radiation dose escalation in carcinoma of the pancreas" doc

Báo cáo khoa học: " A prospective study of differences in duodenum compared to remaining small bowel motion between radiation treatments: Implications for radiation dose escalation in carcinoma of the pancreas" doc

... available AAPM/RTOG treatment planning format into a MATLAB cell-array data object, facilitating manipulation; (2) view- ers which display axial, coronal, and sagittal computed tomography images, ... non-duodenal small bowel. Specifically, the duodenum was contoured from the pylorus to its ascending (fourth) portion, lateral to the head of the pancreas. All remaining...

Ngày tải lên: 09/08/2014, 10:21

5 316 0
báo cáo hóa học: " A prospective study of decline in lung function in relation to welding emissions" pdf

báo cáo hóa học: " A prospective study of decline in lung function in relation to welding emissions" pdf

... mg/dl). Statistical analysis We analyzed the data by two different approaches. In the first approach we used the absolute measured values of lung function to examine the change in FEV 1 and FVC across ... smoking habits may explain the apparent inconsistency. Our data are similar to the findings of Beckett et al [10]. They found an annual decline in FEV 1 among wel...

Ngày tải lên: 20/06/2014, 00:20

8 438 0
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

... first investigate all of our estimators on two re-ranking tasks: a parse selection task and a language model adaptation task. Then we apply the best of these estimators to two additional tasks ... consider, parsing and lan- guage model adaptation are both examples of re-ranking. In these tasks, we assume that we have been given a list of candidates () for each...

Ngày tải lên: 08/03/2014, 02:21

8 505 0
Báo cáo khoa học: A kinetic study of sugarcane sucrose synthase pdf

Báo cáo khoa học: A kinetic study of sugarcane sucrose synthase pdf

... and can have both explanatory and predictive value. Several papers that give a n overview of different approa- ches for studying and modelling metabolism, such as metabolic flux analysis, metabolic ... potential target steps for metabolic engineering, because the reactions in the pathway that have the most potential of modifying a target flux or metabolite c oncen- tration c...

Ngày tải lên: 16/03/2014, 18:20

7 414 0
Báo cáo khoa học: "A Pilot Study of Opinion Summarization in Conversations" docx

Báo cáo khoa học: "A Pilot Study of Opinion Summarization in Conversations" docx

... appears in a dialogue of topic t, and p(w) is the probability of w ap- pearing in a dialogue of any topic. Since our goal is to rank DAs in the same dialog, and the topic is the same for all the DAs, ... Answer- ing the call for a standard reliability measure for cod- ing data. Journal of Communication Methods and Measures, 1:77–89. Minqing Hu and Bing...

Ngày tải lên: 17/03/2014, 00:20

9 442 0
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

... Takezawa, E. Sumita, F. Sugaya, H. Yamamoto, and S. Yamamoto. 2002. Toward a broad-coverage bilingual corpus for speech translation of travel conversations in the real world. In Proceeding of ... LREC-2002, Las Palmas de Gran Canaria, Spain. D. Xiong, Q. Liu and S. Lin. 2006. Maximum Entro- py Based Phrase Reordering Model for Statistical Machine Translation. In Procee...

Ngày tải lên: 17/03/2014, 01:20

8 547 1
Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf

Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf

... goals. The DM may also take into account contextual information 22 Figure 1: Example architecture of an ADS. or historical data before making a decision. After the system has decided what to say, ... varying  and available action density values. At each run, each algorithm was evaluated using the same transition probabilities and available actions. To assess how the algorithm...

Ngày tải lên: 17/03/2014, 22:20

10 499 0
Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

... and bloodstream parasites results in a complete glyoxalase system. Implications for parasite chemotherapy Mammalian cells maintain a repertoire of four path- ways for metabolism of methylglyoxal [33], ... 1-X8 resin (bicarbonate form) to raise the pH to 6.5. After stirring for a further 2–3 h, the resin was again filtered, and the filtrate was adjusted to pH 4.0...

Ngày tải lên: 23/03/2014, 06:20

11 640 0
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

... ATATAT CATATGTCCGGTGTCGCAAAG R-TryX ATATA GGATCCTTACTCGTCTCTCCACGG F-TryP1 ATATAT CATATGTCCTGCGGTAACGCC R-TryP1 ATATA GGATCCTTACTGCTTGCTGAAGTATC F-TDPX1 Cys35Ala CAACGTAGCCAGCAAG GCCGGCTTCACCAAGGGCG R-TDPX1 Cys35Ala ... codons of the mutated amino acids are in bold. Cloned protein or mutation primer (5’- to 3’) F-TDPX1 TATAT CATATGTCTATCTACGACTTCAAGGTC R-TDPX1 ATATA GGATCCTCACGATTGAGT...

Ngày tải lên: 23/03/2014, 07:20

16 484 0
Báo cáo khoa học: A spectroscopic study of the interaction of isoflavones with human serum albumin pdf

Báo cáo khoa học: A spectroscopic study of the interaction of isoflavones with human serum albumin pdf

... interaction are available at the binding site of HSA in order to accommodate genistein in addition to accommodating warfarin. Results obtained from the interaction of genistein and warfarin to HSA ... alongside warfarin to HSA. Binding of genistein in the presence of daidzein The fluorescence of daidzein was found to increase on binding to HSA as mentioned e...

Ngày tải lên: 23/03/2014, 11:20

17 457 0
w