Báo cáo y học: : A new classification of HLA-DRB1 alleles differentiates predisposing and protective alleles for autoantibody production in rheumatoid arthritis" pptx

Báo cáo y học: : A new classification of HLA-DRB1 alleles differentiates predisposing and protective alleles for autoantibody production in rheumatoid arthritis" pptx

Báo cáo y học: : A new classification of HLA-DRB1 alleles differentiates predisposing and protective alleles for autoantibody production in rheumatoid arthritis" pptx

... (boldface ): S1 for ARAA and ERAA, S2 for KRAA, S3 for RRAA (divided into S3P for QRRAA and S3D for DRRAA according to position 70), and X for all non-RAA motifs. The conventional classification of ... new classification of HLA-DRB1 alleles in terms of RF and ACPA production in a cohort of French Caucasian patients with early RA. Interestingl...

Ngày tải lên: 09/08/2014, 10:20

8 691 0
báo cáo hóa học: " A new generalization of the Riemann zeta function and its difference equation" docx

báo cáo hóa học: " A new generalization of the Riemann zeta function and its difference equation" docx

... University of Petroleum and Minerals, Dhahran 31261, Saudi Arabia Full list of author information is available at the end of the article Abstract We have introduced a new generalization of the Riemann ... Fellowship. Author details 1 Department of Mathematics and Statistics, King Fahd University of Petroleum and Minerals, Dhahran 31261, Saudi Arabia 2 Center for Advanc...

Ngày tải lên: 21/06/2014, 02:20

13 438 0
Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps

Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps

... FAM-TTTTGGTATCCCTCTCC-MGB SNP11F ACAGGTTTTGGAAGGCACAGA SNP11 VIC- ACGGAAGAAAAGATTT-MGB SNP11R AATAAAGTGGCAGAGGATACGAGTACT SNP11 FAM-ACGGAAGAAAACATTT-MGB SNP12F AATTGTCTCCCAGTGCATTTTGC SNP12 allele1 ... allele1VIC-TGAAGACCCTGGGC-MGB SNP6R CCCGAAGTCCGAGCACC SNP6 allele2 FAM-TGAAGACCCCGGGC-MGB SNP9F GAAAGTTTTAACACTGGAAACTGCAA SNP9 allele1 VIC-TTTTGGTAGCCCTCTC-MGB SNP9R TTACACTTTCTGCAACAGAAAGTAAG...

Ngày tải lên: 09/08/2014, 07:20

9 559 0
Báo cáo y học: "A Rasch Analysis of the Manchester Foot Pain and Disability Index" pdf

Báo cáo y học: "A Rasch Analysis of the Manchester Foot Pain and Disability Index" pdf

... Pain and Disability Index. Physiotherapy 2007, 9 3:8 9-95. 14. Roddy E, Muller S, Thomas E: Defining disabling foot pain in older adults: further examination of the Manchester Foot Pain and Disability ... Prevalence of lower extremity pain and its association with functionality and quality of life in elderly women in Australia. J Rheumatol 2003, 3 0:2 689-2693. 6. Garr...

Ngày tải lên: 10/08/2014, 21:23

10 362 0
Báo cáo y học: " Myeloid dendritic cells correlate with clinical response whereas plasmacytoid dendritic cells impact autoantibody development in rheumatoid arthritis patients treated with infliximab" pdf

Báo cáo y học: " Myeloid dendritic cells correlate with clinical response whereas plasmacytoid dendritic cells impact autoantibody development in rheumatoid arthritis patients treated with infliximab" pdf

... 2005, 7:R1052-R1055. 23. Jabs WJ, Hennig C, Zawatzky R, Kirchner H: Failure to detect antiviral activity in serum and plasma of healthy individuals displaying high activity in ELISA for IFN-α and IFN-β. J Inter- feron ... Jarrossay D, Facchetti F, Alebardi O, Nakajima H, Lanza- vecchia A, Colonna M: Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amount...

Ngày tải lên: 09/08/2014, 14:22

10 352 0
Báo cáo Y học: A new high affinity binding site for suppressor of cytokine signaling-3 on the erythropoietin receptor potx

Báo cáo Y học: A new high affinity binding site for suppressor of cytokine signaling-3 on the erythropoietin receptor potx

... to increase the binding affinity by providing an additional contact with the SH2 domain of SOCS-3 involving R94. A conforma- tional change induced by the phosphorylation of tyrosine Y4 31 may also ... Masuhara, M., Mitsui, K., Yokouchi, M., Ohtsubo, M., Misawa, H., Miyajima, A. & Yoshimura, A. (1997) CIS, a cytokine inducible SH1 protein, is a target of the JAK- STAT5 pathwa...

Ngày tải lên: 24/03/2014, 00:21

11 579 0
Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx

Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx

... mounting evidence that in ammatory cell in ltrates play a significant role in driving the pathogenesis of asthma and other allergic diseases by damaging tissue and releasing pro -in ammatory agents. ... Binding specificities of the sialoadhesin family of I-type lectins. Sialic acid linkage and substructure requirements for binding of myelin- associated glycoprotein, Schwan...

Ngày tải lên: 24/03/2014, 04:21

14 540 0
Báo cáo y học: "A new approach to understanding the impact of circadian disruption on human health'''' pps

Báo cáo y học: "A new approach to understanding the impact of circadian disruption on human health'''' pps

... here are only the Daysimeter data. Measuring and characterizing circadian behavioral entrainment patterns in nocturnal rodents Data collection Forty albino female Sprague-Dawley rats (Rattus ... cycle was reversed every 48 hours (as if this group of rats instantly travelled back and forth from Asia to the Americas every other day). Animals were housed individually and allowed to ea...

Ngày tải lên: 10/08/2014, 09:20

14 522 0
Báo cáo y học: "A severe coarctation of aorta in a 52-year-old male: a case report"

Báo cáo y học: "A severe coarctation of aorta in a 52-year-old male: a case report"

... 1 Ascending aortography Figure 2 Descending aortography Discussion Aortic coarctation is a congenital vascular lesion typically diagnosed in early life, accounting for 5 to 10% of all ... in adults. In: Alexander RW, et al, eds. Hurst’s The Heart Volume 2, 11th edition. New York: McGraw Hill Professional; 200 4:1 866. 4. Campbell M. Natural history of coarctatio...

Ngày tải lên: 25/10/2012, 11:40

2 487 0
w