Báo cáo khoa học: "The script concordance test in radiation oncology: validation study of a new tool to assess clinical reasoning" potx

... of data and interpretation of data and has been involved in drafting the manuscript. RG contributed to conception and design, analysis and interpretation of data and has been involved in revising ... clearly related to clinical experience. This study provides evidence in favour of SCT as a reliable and valid tool to evaluate the clinical reason- ing of radiati...

Ngày tải lên: 09/08/2014, 09:22

... Radiation Research (IARR) Asociacion Latinoamericana de Terapia Radiante Oncológica (ALATRO) International Union Against Cancer (UICC) Trans Tasmanian Radiation Oncology Group (TROG) International Network ... of proton beams are superior to those of photons • The cost of establishing and maintaining proton facilities is significant • Clinical trials are underway and over the nex...

Ngày tải lên: 09/08/2014, 09:20

... from Anabaena sp. strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress Marion Ruiz, Azzeddine Bettache, Annick Janicki, Daniel Vinella, Cheng-Cai Zhang and Amel Latifi Aix-Marseille ... Latifi A, Ruiz M, Jeanjean R & Zhang CC (2007) PrxQ -A, a member of the peroxiredoxin Q family, plays a major role in defense against oxidative stress in the cyanobacterium...

Ngày tải lên: 18/02/2014, 04:20

... Hemophilus in uenzae is medi- ated by toll-like receptor 2-TAK1-dependent NIK-IKK alpha ⁄ beta-I kappa B alpha and MKK3 ⁄ 6-p38 MAP kinase signaling pathways in epithelial cells. Proc Natl Acad Sci USA ... p38 mitogen-activated protein kinase signaling pathway. J Biol Chem 280, 36185–36194. 13 Shuto T, Imasato A, Jono H, Sakai A, Xu H, Watanabe T, Rixter DD, Kai H, Andalibi A, Linthicum...

Ngày tải lên: 19/02/2014, 00:20

... data confirms the role of TnI as a modulator of the Ca 2+ a nity of TnC; we show that point mutations and incorporation of 5HW in TnI can a ect both the a nity and the cooperativity of Ca 2+ binding ... relative large size and potential for forming or disrupting interactions. The incorporation of 5HW and other non-naturally occurring amino acid analogs into a protein seems...

Ngày tải lên: 20/02/2014, 11:20

... that words appearing in an ad- missible class for an affix A are to be excluded from membership in all classes for affixes contained in A. Thus a word belongs to the admissible class of ... listed above, both - ALIZE and -ATOR can be decomposed into sequences of suffixes already obtained. We have - AL-IZE and -AT-OR. The suffix -AR is new, but -ALIST appears to th...

Ngày tải lên: 07/03/2014, 18:20

... RTEAyF (5¢-CGCGTCTCGCATGCCGATCGGTCCTGGAAGCCT TGCTG-3¢) and JJystrep02 (5¢-ATATTCTAGATTA TTT TTCAAACTGTGGGTGCGACCAATTCGATTGCCCAG AAGACACGTCCCG-3¢). RTEAyF was designed as such that restriction of the generated tatAyCy–strep ... substrate in the cytosol and acts as a guidance factor, targeting substrate molecules to membrane- localized TatCd by a mechanism that would be J. P. Barnett...

Ngày tải lên: 16/03/2014, 04:20

... phase contained 30% total protein and 56% microsomal P450. A pellet was recov- ered containing 2–3% total P450. The lower phase was carefully separated and dialysed against 10 mm Tris ⁄ acetate ... [ 3 H]20E to [ 3 H]E ratio was analysed after 24 h using HPLC. (C) Untreated calli. The biotransformation ratio was normalized to untreated calli, assigned a relative activity of 1. A,...

Ngày tải lên: 16/03/2014, 23:20

... complex in plastids of Arabidopsis thaliana and other Brassicaceae has been examined in detail. It is a hetero-oligomer, slightly larger than its mitochondrial counterpart (350 kDa), associating nucleus- ... have no descendant in plants: large scale alignments including more bacter- ial sequences (available at the EMBL-Align database as ALIGN_000912) place the origin of the eukar...

Ngày tải lên: 16/03/2014, 23:20

... volume of 100 lL containing 8 pmol of each primer (5¢-ATGAACA AAAATCAAAAAGTAACTATT-3¢ and 5¢-TTACCAT TGGTAATGATTAACTCCTCC-3¢), 100 ng template DNA, 0.2 m M of each dNTP, 10 mL 10· Pfu buffer and ... [42]. Specificity of a protein chemical modification reaction can be indicated by the ability of substrate to protect against inactivation. The substrate was added to the incubation...

Ngày tải lên: 23/03/2014, 12:20