Báo cáo khoa học: "Chromosomal radiosensitivity and acute radiation side effects after radiotherapy in tumour patients a follow-up study" ppsx
... Cornetta T, Padua L, Mastellone V, Giammarino D, Testa A, Tirindelli D, Cozzi R, Donato V: DNA repair capacity and acute radiotherapy adverse effects in Italian breast cancer patients. Mutat Res 2010, ... et al.: Chromosomal radiosensitivity and acute radiation side effects after radiotherapy in tumour patients - a follow-up study. Radiation Oncology 2...
Ngày tải lên: 09/08/2014, 09:20
... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACE Zf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACE Zf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACE Zffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCR Zffoxp3-R1 CTTCAACACGCACAAAGCAC Initial ... GTCCAGAATATTCAGCCTTTCACC 3¢-RACE Zftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCR Zftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCR Zf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACE Zf3¢ tbet...
Ngày tải lên: 16/02/2014, 09:20
... citrulline and arginine biosynthesis. AGS, N-acetylglutamate synthase; AGK, N-acetylglutamate kinase; AGPR, N-acetylglutamate 5-phosphate reductase; AOAT, N-acetylornithine transaminase; GAT, glutamate ... glutamate N-acetyltransferase; AOD, N-acetyl- ornithine deacetylase; OCT, ornithine carbamoyltransferase; ASS, argininosuccinate synthase and ASL, argininosuccinate lyase. Wild watermel...
Ngày tải lên: 20/02/2014, 03:20
Báo cáo khóa học: O-acetylation and de-O-acetylation of sialic acids in human colorectal carcinoma docx
... Interest- ingly, the gradual loss of sialic acid O-acetylation, partic- ularly oligo-O-acetylated sialic acids, has been identified as an early alteration accompanying the adenoma-carcinoma sequence in cultured ... de-O-acetylation of sialic acids. O-acetylation of sialic acids in the rat liver Golgi apparatus involves an acetyl intermediate and essential histidine and lysine residues...
Ngày tải lên: 07/03/2014, 14:20
Báo cáo khoa học: "Combining Acoustic and Pragmatic Features to Predict Recognition Performance in Spoken Dialogue Systems" pdf
... in the domain. The feature taskCon- flict indicates a conflict if the current dialogue move type is a command and that command already ap- pears as an active task in the AT. #taskConstraint- Conflict ... misrecognitions) and promoting overall dialogue efficiency, flow, and naturalness. In this paper, we investigate the use of machine learners trained on a combination of acoustic...
Ngày tải lên: 08/03/2014, 04:22
Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx
... MW.Custom- made software and hardware were used for acquisition and analysis of data. Leakage and linear capacity currents were subtracted by using P/4 protocols. Data were sampled once every 5 ls and ... transmembrane domain (TM) are indicated in (A) , and an IgG-like motif is located between residues 22 and 150. (B) C-terminal amino acid sequence comparisons of human b 1B, rat...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: Analysis of the CK2-dependent phosphorylation of serine 13 in Cdc37 using a phospho-specific antibody and phospho-affinity gel electrophoresis doc
... regulated in many different ways. Releasing an inhibitory subunit from a catalytic subunit can activate a kinase. By contrast, binding an activating regulatory coprotein to an inac- tive catalytic ... blotting with anti-Cdc37. Samples were analyzed after dephosphorylation for 0 min (lanes 3 and 7), 3 min (lanes 4 and 8), 10 min (lanes 5 and 9), and 20 min (lanes 6 and 10). Y...
Ngày tải lên: 30/03/2014, 03:20
Báo cáo khoa học: Identification and functional characterization of an aggregation domain in long myosin light chain kinase ppt
... extensively in adhesion molecules and in intracellular cytoskeletal proteins, including titin, MyBP-Cm, MyBP-M, MyBP- H, myotilin, and palladin [30–35]. As Ig-C2 domains may serve as molecular spacers and ... C57BL ⁄ 6, CBA and transgenic lines were maintained at the National Resource Center of Mutated Mice (NRCMM, PR China). The animal protocol was approved by the Institutional A...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: "When Specialists and Generalists Work Together: Overcoming Domain Dependence in Sentiment Tagging" pptx
... tasks within NLP. In sen- timent tagging and related areas, Aue and Gamon (2005) demonstrated that combining classifiers can be a valuable tool in domain adaptation for senti- ment analysis. In ... approaches can be used to take advantage of a small number of anno- tated in- domain examples and/ or of unlabelled in- domain data. The first approach, using general word lists au-...
Ngày tải lên: 31/03/2014, 00:20
Báo cáo khoa học: "Regional Distribution and Relative Frequency of Gastrointestinal Endocrine Cells in Large Intestines of C57BL/6 Mice" potx
... antisera against chromogranin A (CGA), serotonin, somatostatin, human pancreatic polypeptide (HPP), glucagon, gastrin and cholecyctokinin (CCK)-8. Materials and Methods Five adult male and female C57BL/6 ... the gastrointestinal mucosa of a squamata reptile, the grass lizard (Mabuya quinquetaeniata). A histological and immunohistological study. Biomedical Res, 2:639-658, 1981. 4...
Ngày tải lên: 07/08/2014, 15:20