Báo cáo khoa học: "Chromosomal radiosensitivity and acute radiation side effects after radiotherapy in tumour patients a follow-up study" ppsx
Báo cáo khoa học: "Chromosomal radiosensitivity and acute radiation side effects after radiotherapy in tumour patients a follow-up study" ppsx
... Cornetta T, Padua L, Mastellone V, Giammarino D, Testa A,
Tirindelli D, Cozzi R, Donato V: DNA repair capacity and acute
radiotherapy adverse effects in Italian breast cancer patients. Mutat Res
2010, ... et al.: Chromosomal radiosensitivity and acute
radiation side effects after radiotherapy in tumour patients - a follow-up
study. Radiation Oncology 2...
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACE
Zf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACE
Zf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACE
Zffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCR
Zffoxp3-R1 CTTCAACACGCACAAAGCAC Initial ... GTCCAGAATATTCAGCCTTTCACC 3¢-RACE
Zftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCR
Zftbet-R1 CACTGGATGAGACAGGAAGTT Initial PCR
Zf3¢tbet-F1 CTTCTCCAGGACAGTCCAAAGAGTC 3¢-RACE
Zf3¢
tbet...
Tài liệu Báo cáo khoa học: Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc
... citrulline and arginine biosynthesis. AGS,
N-acetylglutamate synthase; AGK, N-acetylglutamate kinase; AGPR,
N-acetylglutamate 5-phosphate reductase; AOAT, N-acetylornithine
transaminase; GAT, glutamate ... glutamate N-acetyltransferase; AOD, N-acetyl-
ornithine deacetylase; OCT, ornithine carbamoyltransferase; ASS,
argininosuccinate synthase and ASL, argininosuccinate lyase.
Wild watermel...
Báo cáo khóa học: O-acetylation and de-O-acetylation of sialic acids in human colorectal carcinoma docx
... Interest-
ingly, the gradual loss of sialic acid O-acetylation, partic-
ularly oligo-O-acetylated sialic acids, has been identified as
an early alteration accompanying the adenoma-carcinoma
sequence in cultured ... de-O-acetylation of sialic acids. O-acetylation of sialic acids in
the rat liver Golgi apparatus involves an acetyl intermediate and
essential histidine and lysine residues...
Báo cáo khoa học: "Combining Acoustic and Pragmatic Features to Predict Recognition Performance in Spoken Dialogue Systems" pdf
... in the domain. The feature taskCon-
flict indicates a conflict if the current dialogue move
type is a command and that command already ap-
pears as an active task in the AT. #taskConstraint-
Conflict ... misrecognitions) and promoting
overall dialogue efficiency, flow, and naturalness.
In this paper, we investigate the use of machine
learners trained on a combination of acoustic...
Báo cáo khoa học: Molecular cloning and functional expression of the human sodium channel b1B subunit, a novel splicing variant of the b1 subunit potx
... MW.Custom-
made software and hardware were used for acquisition and
analysis of data. Leakage and linear capacity currents were
subtracted by using P/4 protocols. Data were sampled once
every 5 ls and ... transmembrane
domain (TM) are indicated in (A) , and an
IgG-like motif is located between residues 22
and 150. (B) C-terminal amino acid sequence
comparisons of human b
1B,
rat...
Báo cáo khoa học: Analysis of the CK2-dependent phosphorylation of serine 13 in Cdc37 using a phospho-specific antibody and phospho-affinity gel electrophoresis doc
... regulated in many
different ways. Releasing an inhibitory subunit from a
catalytic subunit can activate a kinase. By contrast,
binding an activating regulatory coprotein to an inac-
tive catalytic ... blotting with anti-Cdc37. Samples
were analyzed after dephosphorylation for 0 min (lanes 3 and 7),
3 min (lanes 4 and 8), 10 min (lanes 5 and 9), and 20 min (lanes 6
and 10).
Y...
Báo cáo khoa học: Identification and functional characterization of an aggregation domain in long myosin light chain kinase ppt
... extensively in
adhesion molecules and in intracellular cytoskeletal
proteins, including titin, MyBP-Cm, MyBP-M, MyBP-
H, myotilin, and palladin [30–35]. As Ig-C2 domains
may serve as molecular spacers and ... C57BL ⁄ 6, CBA and transgenic lines were
maintained at the National Resource Center of Mutated
Mice (NRCMM, PR China). The animal protocol was
approved by the Institutional A...
Báo cáo khoa học: "When Specialists and Generalists Work Together: Overcoming Domain Dependence in Sentiment Tagging" pptx
... tasks within NLP. In sen-
timent tagging and related areas, Aue and Gamon
(2005) demonstrated that combining classifiers can
be a valuable tool in domain adaptation for senti-
ment analysis. In ... approaches can be
used to take advantage of a small number of anno-
tated in- domain examples and/ or of unlabelled in-
domain data.
The first approach, using general word lists au-...
Báo cáo khoa học: "Regional Distribution and Relative Frequency of Gastrointestinal Endocrine Cells in Large Intestines of C57BL/6 Mice" potx
... antisera
against chromogranin A (CGA), serotonin, somatostatin,
human pancreatic polypeptide (HPP), glucagon, gastrin and
cholecyctokinin (CCK)-8.
Materials and Methods
Five adult male and female C57BL/6 ... the
gastrointestinal mucosa of a squamata reptile, the grass
lizard (Mabuya quinquetaeniata). A histological and
immunohistological study. Biomedical Res, 2:639-658,
1981.
4...
Từ khóa: