Báo cáo khoa học: "Successful radiation treatment of anaplastic thyroid carcinoma metastatic to the right cardiac atrium and ventricle in a pacemaker-dependent patient" pps

Báo cáo khoa học: "Successful radiation treatment of anaplastic thyroid carcinoma metastatic to the right cardiac atrium and ventricle in a pacemaker-dependent patient" pps

Báo cáo khoa học: "Successful radiation treatment of anaplastic thyroid carcinoma metastatic to the right cardiac atrium and ventricle in a pacemaker-dependent patient" pps

... Access Successful radiation treatment of anaplastic thyroid carcinoma metastatic to the right cardiac atrium and ventricle in a pacemaker-dependent patient Tina Dasgupta * , Igor J Barani, Mack ... this article as: Dasgupta et al.: Successful radiation treatment of anaplastic thyroid carcinoma metastatic to the right cardiac atrium an...
Ngày tải lên : 09/08/2014, 09:20
  • 8
  • 328
  • 0
Báo cáo khoa học: "AN IMPROPER TREATMENT OF QUANTIFICATION IN ORDINARY" pot

Báo cáo khoa học: "AN IMPROPER TREATMENT OF QUANTIFICATION IN ORDINARY" pot

... generally we can move from entities at one grain to entities at a coarser grain by means of an arbitrary partition. Fine-grained entities in the same equivalence class are indistinguishable at ... That is, the properties of the typical element at the coarser grain are also the properties of the real elements at the finer grain, and the typical element has...
Ngày tải lên : 31/03/2014, 17:20
  • 7
  • 321
  • 0
Báo cáo khoa học: "Gene expression profiling of human dermal fibroblasts exposed to bleomycin sulphate does not differentiate between radiation sensitive and control patients" pptx

Báo cáo khoa học: "Gene expression profiling of human dermal fibroblasts exposed to bleomycin sulphate does not differentiate between radiation sensitive and control patients" pptx

... McDonald S, Finkelstein JN: A perpetual cascade of cytokines postirradiation leads to pulmonary fibrosis. Int J Radiat Oncol Biol Phys 1995, 33(1) :99-109. 14. Yamamoto T, Takagawa S, Katayama I, ... statistical analysis, carried out cell and RNA preparation and drafted the manuscript. KKS participated in study design, performed statistical analysis and helped to draft the...
Ngày tải lên : 09/08/2014, 09:20
  • 6
  • 355
  • 0
Báo cáo khoa học: "Successful radiopeptide targeting of metastatic anaplastic meningioma: Case report" pptx

Báo cáo khoa học: "Successful radiopeptide targeting of metastatic anaplastic meningioma: Case report" pptx

... visualisation of PET/CT demonstrating the intracranial meningioma and its pulmonary metastases. Figure 2 SPECT/CT images of somatostatin r eceptor scintigraphy display avid uptake in the intracranial meningioma ... may be also used in other tumors expressing somatostatin receptors such as neuroblastoma, pheochromocytoma and para- ganglioma [13-15]. This procedure is used apart...
Ngày tải lên : 09/08/2014, 09:21
  • 3
  • 261
  • 0
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf

... 2499–2513. 9 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, Nanakin A, Sawabu T, Uenoyama Y et al. (2004) STAT3 is constitutively activated and supports cell survival in association ... lines: inhibition of JAK3 ⁄ STAT3 signaling induces apoptosis and cell cycle arrest of colon carcinoma cells. Am J Pathol 167, 969–980. 27 Kunnumakkara AB, Anand P & A...
Ngày tải lên : 18/02/2014, 08:20
  • 11
  • 558
  • 0
Tài liệu Báo cáo khoa học: Photochemical cross-linking of Escherichia coli Fpg protein to DNA duplexes containing pdf

Tài liệu Báo cáo khoa học: Photochemical cross-linking of Escherichia coli Fpg protein to DNA duplexes containing pdf

... autoradiography and silver staining. Equal mobilities of the radioactive and the protein-containing bands indicated covalent attachment of DNA to the enzyme. The yield of the photochemical cross-linking reaction ... formamidopyrimidine-DNA glycosylase (Fpg protein) is a DNA repair enzyme that catalyzes the removal of oxidized purine bases from damaged DNA and cle...
Ngày tải lên : 20/02/2014, 11:20
  • 5
  • 339
  • 0
Báo cáo khoa học: Phosphorylation-dependent binding of human transcription factor MOK2 to lamin A⁄C pot

Báo cáo khoa học: Phosphorylation-dependent binding of human transcription factor MOK2 to lamin A⁄C pot

... phosphory- lated and then released from lamin A ⁄ C. This regula- tion may take place following activation of kinases such as PKA in response to various signaling pathways. In addition, Aurora A kinase ... 293–302. 20 Ohashi S, Sakashita G, Ban R, Nagasawa M, Matsuzaki H, Murata Y, Taniguchi H, Shima H, Furukawa K & Urano T (2006) Phospho-regulation of human protein kinase...
Ngày tải lên : 07/03/2014, 01:20
  • 11
  • 378
  • 0
Báo cáo khoa học: "Project for production of closed-caption TV programs for the hearing impaired" docx

Báo cáo khoa học: "Project for production of closed-caption TV programs for the hearing impaired" docx

... Uehara Shibuya-ku, Tokyo 151-0064, Japan wakao@shibuya.tao.or.jp Eiji Sawamura TAO Terumasa Ehara NHK Science and Technical Research Lab / TAO Ichiro Maruyama TAO Katsuhiko Shirai Waseda ... contrast to 70 % in the United States and more than 30 % in Britain. Reasons why the availability is low are firstly the characters used in the Japanese language are comp...
Ngày tải lên : 08/03/2014, 06:20
  • 5
  • 445
  • 0
Báo cáo khoa học: Outer sphere mutagenesis of Lactobacillus plantarum manganese catalase disrupts the cluster core pptx

Báo cáo khoa học: Outer sphere mutagenesis of Lactobacillus plantarum manganese catalase disrupts the cluster core pptx

... 5¢-GT TGAGATACTTGATTATATCAAAGGTTCTTATGA ATATTTGACTCATGAATC-3¢ and its complement. The LPC structural gene (katM) was PCR amplified from pG + host5LPC using the primers 5¢-CCGCATATGTTC AAACATACAAGAAAACTGCAATACAACGCAAA ACC-3¢ ... its native promoter was PCR amplified from L. plantarum genomic DNA (using the primers 5¢-GCGAGGATCCAACCGACTATT GACTGGTAAAAAAGCAGTTACCCCTAACCAG-3¢ and 5¢-GAGCG...
Ngày tải lên : 08/03/2014, 08:20
  • 15
  • 331
  • 0

Xem thêm