Báo cáo khoa học: "Age is not a limiting factor for brachytherapy for carcinoma of the node negative oral tongue in patients aged eighty or older" docx

Báo cáo khoa học: "Age is not a limiting factor for brachytherapy for carcinoma of the node negative oral tongue in patients aged eighty or older" docx

Báo cáo khoa học: "Age is not a limiting factor for brachytherapy for carcinoma of the node negative oral tongue in patients aged eighty or older" docx

... 5:116 http://www.ro-journal.com/content/5/1/116 Page 5 of 7 RESEARCH Open Access Age is not a limiting factor for brachytherapy for carcinoma of the node negative oral tongue in patients aged eighty or older Hideya ... potential Prognostic Factors. Tumori 2009, 95:461-6. doi:10.1186/1748-717X-5-116 Cite this article as: Yamazaki et al.: Age is not...

Ngày tải lên: 09/08/2014, 09:20

7 367 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

... kinetics. For this reason, we decided to mea- sure the lag-phase of the reaction, i.e. the time before an apparent increase in absorbance of 0.1 was recorded. The addition of PDI to the assay accelerated ... examined using the insulin precipitation assay. In the noncatalyzed assay, the disulfides of insulin are reduced by dithiothreitol, causing the aggregation...

Ngày tải lên: 16/02/2014, 14:20

9 621 0
Báo cáo khoa học: "MIX Is Not a Tree-Adjoining Language" doc

Báo cáo khoa học: "MIX Is Not a Tree-Adjoining Language" doc

... ← is a terminating rule, then a tree with a single node labeled by A( w 1 , w 2 )isa derivation tree for A( w 1 , w 2 ). S(aa a aa a, #¯aa a aaa) D(aa a aa a, ¯aa a aaa) F(aa a a, a aaa) A( a, a) ... E (a a a, a aa) D (a a, ¯aa) F (a a, ¯aa) A( a, a) E( a, a) D(ε, ε) A  ( a, a) D(ε, ε) A  ( a, a) D (a a, ¯aa) F (a a, ¯aa) A( a, a) E( a, a) D(ε, ε) A  ( a, a)...

Ngày tải lên: 16/03/2014, 19:20

9 374 0
Tài liệu Báo cáo khoa học: It is all about resolution Meeting report based upon presentations at the 10th International Global BioMillennium 2006 symposium on molecular cell biology (Tbilisi, Georgia) docx

Tài liệu Báo cáo khoa học: It is all about resolution Meeting report based upon presentations at the 10th International Global BioMillennium 2006 symposium on molecular cell biology (Tbilisi, Georgia) docx

... by Aaron Ciechanover (Haifa, Israel), who argued that the ubiquitin proteolytic system covers the pathway for elucidating the basic mechanisms that are pivotal for drug targeting. Degradation of ... that differ substantially in their biochemical properties and intracellular localization. DAP-kinases (DAPk), Ca 2+ ⁄ calmodulin-regulated and Ser ⁄Thr kinases, activate signaling pa...

Ngày tải lên: 19/02/2014, 02:20

4 515 1
Báo cáo khoa học: Saporin and ricin A chain follow different intracellular routes to enter the cytosol of intoxicated cells pptx

Báo cáo khoa học: Saporin and ricin A chain follow different intracellular routes to enter the cytosol of intoxicated cells pptx

... mole of saporin was incorporated. The cytotoxicity of the Cy3–sap- orin was assayed and was unchanged as compared to the native saporin, used for the labeling. Saporin uptake and intracellular immunofluorescence Green ... complex is not a major intra- cellular compartment for productive trafficking of sap- orin. When we investigated the intracellular route of a hum...

Ngày tải lên: 23/03/2014, 15:21

13 389 0
Báo cáo khoa học: " Champignons phytopathogènes associés à deux coléoptères scolytidae du pin sylvestre (Pinus sylvestris L.) et étude préliminaire de leur agressivité envers l’hôte" doc

Báo cáo khoa học: " Champignons phytopathogènes associés à deux coléoptères scolytidae du pin sylvestre (Pinus sylvestris L.) et étude préliminaire de leur agressivité envers l’hôte" doc

... associated with bark beetles in Poland. Planta Polonica7, 1-54 Upadhyay H.P. (1981) A monograph of Cerato- cystis and Ceralaocystiopsis. The University of Georgia Press, Athens, ... of playing a role in the mechanisms of the establishment of I. sexdentatus in scots pine, because of their aggressiveness and their high constancy. L. wingfie...

Ngày tải lên: 09/08/2014, 02:21

16 271 0
Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt

Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt

... 216 GGACCGGAAGTCCATGGCCCCTCATACTTCAGGGTGCAGCTGCGGGAGCAGCACCTGTATTACCAGGACCAG 288 CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTGCTACAGCGTTAAGAACGGGGCGGACATCGCCCTG 360 CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCCGGTCACCCTGCCCCCTGAGTCGGAGACC ... 360 CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCCGGTCACCCTGCCCCCTGAGTCGGAGACC 432 TTCCCCCCGGGGACGCAGTGCTGGGTGACGGGCTGGGGCAACGTGGACAATGGAAGGCGCCTGCCGCCCCCA 504 TT...

Ngày tải lên: 17/03/2014, 09:20

11 527 0
Báo cáo khoa học: Ribonuclease H: molecular diversities, substrate binding domains, and catalytic mechanism of the prokaryotic enzymes ppt

Báo cáo khoa học: Ribonuclease H: molecular diversities, substrate binding domains, and catalytic mechanism of the prokaryotic enzymes ppt

... Schematic representation of the two-metal-ion catalysis mechanism proposed for RNase H. The side chains of the first aspartate, second glutamate, third aspartate and fourth aspartate residues of the ... binding more greatly than the latter [9]. TBP binds to the target DNA at the flat surface of the molecule [14–16]. The N-terminal domain of RNase HIII probably uses...

Ngày tải lên: 30/03/2014, 02:20

12 313 0
Báo cáo khoa học: Large-scale overproduction, functional purification and ligand affinities of the His-tagged human histamine H1 receptor ppt

Báo cáo khoa học: Large-scale overproduction, functional purification and ligand affinities of the His-tagged human histamine H1 receptor ppt

... position of the intact His- tagged H1 receptor is indicated by the arrow. The quantity of the remaining minor contaminating bands in the purified receptor varied between preparations. Their identity is ... mg of functional receptor from a 10 L culture, making this approach promising as an alternative for the classical nondisposable glass or steel bioreactor set-up...

Ngày tải lên: 30/03/2014, 14:20

11 552 0
Báo cáo khoa học: " Preoperative external beam radiotherapy and reduced dose brachytherapy for carcinoma of the cervix: survival and pathological response" potx

Báo cáo khoa học: " Preoperative external beam radiotherapy and reduced dose brachytherapy for carcinoma of the cervix: survival and pathological response" potx

... remission after preoperative intracavitary radiotherapy of cervical cancer stage Ib and IIa is a strong prognostic factor for long-term survival: analysis of the Radiumhemmet data 1989-1991. Int ... Median age was 46 years (range 22–72). Squamous cell carcinoma was the histological type in 56 patients (84%); adenocarcinoma in 9 (13%); and 2 patients (3%) had other hi...

Ngày tải lên: 09/08/2014, 10:21

8 310 0
Từ khóa:
w