0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Age is not a limiting factor for brachytherapy for carcinoma of the node negative oral tongue in patients aged eighty or older" docx

Báo cáo khoa học:

Báo cáo khoa học: "Age is not a limiting factor for brachytherapy for carcinoma of the node negative oral tongue in patients aged eighty or older" docx

... 5:116http://www.ro-journal.com/content/5/1/116Page 5 of 7RESEARCH Open AccessAge is not a limiting factor for brachytherapy for carcinoma of the node negative oral tongue in patients aged eighty or olderHideya ... potential Prognostic Factors. Tumori 2009,95:461-6.doi:10.1186/1748-717X-5-116Cite this article as: Yamazaki et al.: Age is not a limiting factor for brachytherapy for carcinoma of the node negative ... JP, Meta-Analysis of Radiotherapy in Carcinomas of Head and neck (MARCH)Collaborative Group: Hyperfractionated or accelerated radiotherapy in head and neck cancer: a meta-analysis. Lancet 2006,...
  • 7
  • 367
  • 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx

... kinetics. For this reason, we decided to mea-sure the lag-phase of the reaction, i.e. the time before anapparent increase in absorbance of 0.1 was recorded. The addition of PDI to the assay accelerated ... examined using the insulin precipitation assay. In the noncatalyzed assay, the disulfides of insulin arereduced by dithiothreitol, causing the aggregation andprecipitation of the B-chain of insulin, ... that bacitracinshould not be regarded as a specific inhibitor of PDI.ResultsBacitracin does not inhibit the catalysis of disulfide bond formation and isomerization by PDIPDI is a catalyst of...
  • 9
  • 620
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "MIX Is Not a Tree-Adjoining Language" doc

... ← is a terminating rule, then a treewith a single node labeled by A( w1, w2)isaderivation tree for A( w1, w2).S(aa a aa a, #¯aa a aaa)D(aa a aa a, ¯aa a aaa)F(aa a a, a aaa) A( a, a) ... E (a a a, a aa)D (a a, ¯aa)F (a a, ¯aa) A( a, a) E( a, a) D(ε, ε) A ( a, a) D(ε, ε) A ( a, a) D (a a, ¯aa)F (a a, ¯aa) A( a, a) E( a, a) D(ε, ε) A ( a, a) D(ε, ε)C(ε, #)Figure 1: An ... of the first t hree types arebinary rules and rules of the last type are terminat-ing rules.Thisdefinition of a head grammar actu-ally corresponds to a normal form for head gram-mars that appears...
  • 9
  • 374
  • 0
Tài liệu Báo cáo khoa học: It is all about resolution Meeting report based upon presentations at the 10th International Global BioMillennium 2006 symposium on molecular cell biology (Tbilisi, Georgia) docx

Tài liệu Báo cáo khoa học: It is all about resolution Meeting report based upon presentations at the 10th International Global BioMillennium 2006 symposium on molecular cell biology (Tbilisi, Georgia) docx

... by AaronCiechanover (Haifa, Israel), who argued that the ubiquitin proteolytic system covers the pathway for elucidating the basic mechanisms that are pivotal for drug targeting. Degradation of ... that differ substantially in theirbiochemical properties and intracellular localization.DAP-kinases (DAPk), Ca2+⁄ calmodulin-regulatedand Ser ⁄Thr kinases, activate signaling pathways thatlead ... platforms. Appliedto six publicly available cancer microarray gene expres-sion datasets from three pairs of studies, this approachwas used for examining breast cancer, prostate cancerand acute...
  • 4
  • 510
  • 0
Báo cáo khoa học: Saporin and ricin A chain follow different intracellular routes to enter the cytosol of intoxicated cells pptx

Báo cáo khoa học: Saporin and ricin A chain follow different intracellular routes to enter the cytosol of intoxicated cells pptx

... mole of saporin was incorporated. The cytotoxicity of the Cy3–sap-orin was assayed and was unchanged as compared to the native saporin, used for the labeling.Saporin uptake and intracellularimmunofluorescenceGreen ... complex is not a major intra-cellular compartment for productive trafficking of sap-orin. When we investigated the intracellular route of a human prourokinase–saporin TRITC conjugate [33], the fluorescence ... 571–578.52 Sambrook T, Fritsch EF & Maniatis T (1989) MolecularCloning. A Laboratory Manual. Cold Spring HarborLaboratory Press, Cold Spring Harbor, NY.R. Vago et al. Saporin trafficking in intoxicated...
  • 13
  • 389
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Champignons phytopathogènes associés à deux coléoptères scolytidae du pin sylvestre (Pinus sylvestris L.) et étude préliminaire de leur agressivité envers l’hôte" doc

... associated withbark beetles in Poland. Planta Polonica7, 1-54Upadhyay H.P. (1981) A monograph of Cerato-cystis and Ceralaocystiopsis. The University of Georgia Press, Athens, ... of playing a role in the mechanisms of the establishment of I. sexdentatus in scots pine, because of their aggressivenessand their high constancy. L. wingfieldii has a good ... was foll’owed over a period of 3 years for I. sexdentatus, 4 years for T. piniperda, along the maturation stages of the adults. O. brunneo-ciliatum and O. ips had a...
  • 16
  • 271
  • 0
Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt

Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt

... 216GGACCGGAAGTCCATGGCCCCTCATACTTCAGGGTGCAGCTGCGGGAGCAGCACCTGTATTACCAGGACCAG 288CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTGCTACAGCGTTAAGAACGGGGCGGACATCGCCCTG 360CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCCGGTCACCCTGCCCCCTGAGTCGGAGACC ... 360CTGGAGCTGGACAAGCTTGTGAATATCTCCTGGCACGTCCAGCCGGTCACCCTGCCCCCTGAGTCGGAGACC 432TTCCCCCCGGGGACGCAGTGCTGGGTGACGGGCTGGGGCAACGTGGACAATGGAAGGCGCCTGCCGCCCCCA 504TTCCCCCTGAAGCAGGTGAAGGTGCCCGTCGTGGAGAACAGTGTCTGTGACAGGAAGTACCACTCTGGCCTG 576TCCACAGGGGACAACGTCCCCATCGTGCGGGAGGACATGCTGTGTGCTGGGGACAGCGGGAGGAACTTCTGC ... eitherusing the Sequenase 2.0 Kit (Amersham Pharmacia BiotechItalia) or automatically.cDNA synthesismRNA was prepared from various bovine tissues using the Fast Track kit (Invitrogen, USA)....
  • 11
  • 527
  • 0
Báo cáo khoa học: Ribonuclease H: molecular diversities, substrate binding domains, and catalytic mechanism of the prokaryotic enzymes ppt

Báo cáo khoa học: Ribonuclease H: molecular diversities, substrate binding domains, and catalytic mechanism of the prokaryotic enzymes ppt

... Schematic representation of the two-metal-ion catalysismechanism proposed for RNase H. The side chains of the firstaspartate, second glutamate, third aspartate and fourth aspartateresidues of the ... binding moregreatly than the latter [9]. TBP binds to the targetDNA at the flat surface of the molecule [14–16]. The N-terminal domain of RNase HIII probably uses the same surface for substrate ... Glu186, Asp210 and Asp274 for human RNase H1, and Asp443, Glu478, Asp498 and Asp549 for HIV-1 RNase H. The fourth aspartate residue is replaced by the glutamate residue for RNase HIII. The attacking...
  • 12
  • 313
  • 0
Báo cáo khoa học: Large-scale overproduction, functional purification and ligand affinities of the His-tagged human histamine H1 receptor ppt

Báo cáo khoa học: Large-scale overproduction, functional purification and ligand affinities of the His-tagged human histamine H1 receptor ppt

... position of the intact His-tagged H1 receptor is indicated by the arrow. The quantity of the remaining minor contaminating bands in the purified receptor variedbetween preparations. Their identity is ... mg of functional receptor from a 10 L culture, makingthis approach promising as an alternative for the classicalnondisposable glass or steel bioreactor set-up, which is quite time-consuming in ... not affect ligand binding. This is in line withobservations for other receptors [17,20,27]. According toSDS/PAGE the recombinant receptor migrates with anapparent mass of 55 ± 5 kDa. This corresponds...
  • 11
  • 552
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Preoperative external beam radiotherapy and reduced dose brachytherapy for carcinoma of the cervix: survival and pathological response" potx

... remission after preoperativeintracavitary radiotherapy of cervical cancer stage Ib and IIa is a strong prognostic factor for long-term survival: analysis of the Radiumhemmet data 1989-1991. Int ... Median age was 46 years (range 22–72). Squamouscell carcinoma was the histological type in 56 patients (84%); adenocarcinoma in 9 (13%); and 2 patients (3%)had other histologies. Clinical staging ... control. In fact, the standard approach for advancedcervical cancer has been changed after 3 randomized trialsand a meta-analysis demonstrate significant benefit of concomitant chemoradiotherapy...
  • 8
  • 310
  • 0

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP