Báo cáo khoa học: "Accelerated Partial Breast Irradiation (APBI): A review of available techniques" doc
... Hiraoka M: Current status of accelerated partial breast irradiation. Breast Cancer 2008, 15:101-107. 24. Arthur DW, Vicini FA: Accelerated partial breast irradiation as a part of breast conservation ... Chopra S, Badwe R, Hawaldar R, Parmar V, Jalali R, Sarin R: Quality of life after accelerated partial breast irradiation in early breast cancer: matched pair ana...
Ngày tải lên: 09/08/2014, 09:20
... Hiraoka M: Current status of accelerated partial breast irradiation. Breast Cancer 2008, 15:101-107. 27. Powell SN: The radiobiology of accelerated partial breast irradiation. In Accelerated partial ... the use of breast- conserving therapy in stage I and II breast carcinoma. J Clin Oncol 2001, 19:2254-2262. 4. Arthur DW, Vicini FA: Accelerated partial breast irr...
Ngày tải lên: 09/08/2014, 09:20
... intra- cellular metabolites. An approach that combines flux balance analysis (FBA) with an ordinary differential equation (o.d.e.) model of the slow time scales is called dynamic flux balance analysis (dFBA), ... activates adenylate cyclase (CyaA) and leads to an increase in the intra- cellular cyclic AMP (cAMP) level [1]. Mathematical models of catabolite repression in E. coli The (isolate...
Ngày tải lên: 18/02/2014, 13:20
Báo cáo khoa học: "Can prophylactic breast irradiation contribute to cardiac toxicity in patients with prostate cancer receiving androgen suppressing drugs?" ppt
... Neo- adjuvant and adjuvant hormone therapy for localised and locally advanced prostate cancer. Cochrane Database Syst Rev 2006:CD006019. 2. Keating NL, O'Malley AJ, Smith MR: Diabetes and cardiovascular disease ... to a part of the heart (2 had no history of cardiac disease). When using the clinically rather than CT-determined beam energy, as often done in daily practice, an additi...
Ngày tải lên: 09/08/2014, 09:22
Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx
... overall reaction [50]. A rationally designed variant of L -Ala- D / L -Glu epimerase (a third member of the enolase superfamily, Fig. 8), containing a mutation (D297G) analogous to that of the E223G ... by plasmid pKIMP-UAUC. Random gene libraries are introduced into this strain and the ability of a cell harboring an individual library member to form a colony on minimal agar...
Ngày tải lên: 19/02/2014, 12:20
Báo cáo khoa học: Calix[4]arene methylenebisphosphonic acids as inhibitors of fibrin polymerization doc
... Coleman et al. [16] demonstrated anticoagu- lant activity for derivatives of two para-octanoylca- lix[8]arenes. An attempt was made to elucidate the mechanism of the antithrombotic activity of ... ini- tially demonstrated in 1995 [14]. Subsequently, Da Silva et al. [15] showed that two para-sulfonato- calix[8]arenes essentially increase an activated partial thromboplastin time (APTT)...
Ngày tải lên: 06/03/2014, 00:21
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot
... CGCTTTCGGAGGTGCTTTCGCAG M1941p65.R: TCAGAGTTCCCTACCGAAGCAG P0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGCCAT p21 WAF1/CIP1 Cyclin-dependent ... inverted terminal repeat amplification were: 1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGC ATGGC-3¢; and AAV65MGB/taq, 5¢-G...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx
... the ERK1 ⁄ 2 pathway, the PKB pathway and the Janus kinase ⁄ signal transducer and activator of tran- scription (JAK-STAT) pathway, to promote prolifera- tion, survival and transformation [56,57]. ... 854–864. 62 Kuribara R, Honda H, Matsui H, Shinjyo T, Inukai T, Sugita K, Nakazawa S, Hirai H, Ozawa K & Inaba T (2009) Roles of Bim in apoptosis of normal and Bcr-Abl-expressing hemat...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: "Grounded Language Modeling for Automatic Speech Recognition of Sports Video" doc
... with traditional unigram, bigram, and trigram lan- guage models generated from a combination of the closed captioning transcripts of all training games and data from the switchboard corpus ... unlabeled games are used to train unigram, bigram, and trigram grounded lan- guage models. Only unigrams, bigrams, and tri- grams that are not proper names, appear greater than three times, an...
Ngày tải lên: 17/03/2014, 02:20
Báo cáo khoa học: "Robust Word Sense Translation by EM Learning of Frame Semantics" docx
... the translation process of a statistical machine trans- lation system. Manual inspection of the contras- tive error analysis data from a state -of- the-art SMT system showed that around 20% of the ... translation results are more accurate. 5 Towards Translation Disambiguation using Frame Semantics As translation disambiguation forms the core of various machine translation st...
Ngày tải lên: 17/03/2014, 04:20