Báo cáo khoa học: "Accelerated Partial Breast Irradiation (APBI): A review of available techniques" doc
Báo cáo khoa học: "Accelerated Partial Breast Irradiation (APBI): A review of available techniques" doc
... Hiraoka M: Current status of accelerated partial breast
irradiation. Breast Cancer 2008, 15:101-107.
24. Arthur DW, Vicini FA: Accelerated partial breast irradiation as a part of
breast conservation ... Chopra S, Badwe R, Hawaldar R, Parmar V,
Jalali R, Sarin R: Quality of life after accelerated partial breast irradiation
in early breast cancer: matched pair ana...
Báo cáo khoa học: " Accelerated partial breast irradiation using multicatheter brachytherapy for select early-stage breast cancer: local control and toxicity" potx
... Hiraoka M: Current status of accelerated partial breast
irradiation. Breast Cancer 2008, 15:101-107.
27. Powell SN: The radiobiology of accelerated partial breast irradiation. In
Accelerated partial ... the use of breast- conserving therapy
in stage I and II breast carcinoma. J Clin Oncol 2001, 19:2254-2262.
4. Arthur DW, Vicini FA: Accelerated partial breast irr...
Tài liệu Báo cáo khoa học: Catabolite repression in Escherichia coli – a comparison of modelling approaches docx
... intra-
cellular metabolites. An approach that combines flux
balance analysis (FBA) with an ordinary differential
equation (o.d.e.) model of the slow time scales is called
dynamic flux balance analysis (dFBA), ... activates adenylate
cyclase (CyaA) and leads to an increase in the intra-
cellular cyclic AMP (cAMP) level [1].
Mathematical models of catabolite
repression in E. coli
The (isolate...
Báo cáo khoa học: "Can prophylactic breast irradiation contribute to cardiac toxicity in patients with prostate cancer receiving androgen suppressing drugs?" ppt
... Neo-
adjuvant and adjuvant hormone therapy for localised and
locally advanced prostate cancer. Cochrane Database Syst Rev
2006:CD006019.
2. Keating NL, O'Malley AJ, Smith MR: Diabetes and cardiovascular
disease ... to a part of the heart
(2 had no history of cardiac disease). When using the clinically rather than CT-determined beam
energy, as often done in daily practice, an additi...
Tài liệu Báo cáo khoa học: Deciphering enzymes Genetic selection as a probe of structure and mechanism docx
... overall reaction [50].
A rationally designed variant of
L
-Ala-
D
/
L
-Glu epimerase
(a third member of the enolase superfamily, Fig. 8),
containing a mutation (D297G) analogous to that of the
E223G ... by plasmid pKIMP-UAUC. Random gene libraries are introduced into this strain
and the ability of a cell harboring an individual library member to form a colony on minimal agar...
![Báo cáo khoa học: Calix[4]arene methylenebisphosphonic acids as inhibitors of fibrin polymerization doc](https://media.store123doc.com/images/document/14/rc/tp/medium_tpb1394040066.jpg)
Báo cáo khoa học: Calix[4]arene methylenebisphosphonic acids as inhibitors of fibrin polymerization doc
... Coleman et al. [16] demonstrated anticoagu-
lant activity for derivatives of two para-octanoylca-
lix[8]arenes. An attempt was made to elucidate the
mechanism of the antithrombotic activity of ... ini-
tially demonstrated in 1995 [14]. Subsequently,
Da Silva et al. [15] showed that two para-sulfonato-
calix[8]arenes essentially increase an activated partial
thromboplastin time (APTT)...
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot
... CGCTTTCGGAGGTGCTTTCGCAG
M1941p65.R: TCAGAGTTCCCTACCGAAGCAG
P0 Acidic ribosomal phosphoprotein XR_004667 MH181PO.F: CTCCAAGCAGATGCAGCAGA
M225PO.P: CCGTGGTGCTGATGGGCAAGAA
M267PO.R: ACCATGATGCGCAAGGCCAT
p21
WAF1/CIP1
Cyclin-dependent ... inverted terminal repeat amplification were:
1AAV65/Fwd, 5¢-CTCCATCACTAGGGGTTCCTTGT
A- 3¢; 64AAV65/rev, 5¢-TGGCTACGTAGATAAGTAGC
ATGGC-3¢; and AAV65MGB/taq, 5¢-G...
Báo cáo khoa học: Apoptosis and autophagy: BIM as a mediator of tumour cell death in response to oncogene-targeted therapeutics pptx
... the ERK1 ⁄ 2 pathway, the PKB pathway and the
Janus kinase ⁄ signal transducer and activator of tran-
scription (JAK-STAT) pathway, to promote prolifera-
tion, survival and transformation [56,57]. ... 854–864.
62 Kuribara R, Honda H, Matsui H, Shinjyo T, Inukai T,
Sugita K, Nakazawa S, Hirai H, Ozawa K & Inaba T
(2009) Roles of Bim in apoptosis of normal and
Bcr-Abl-expressing hemat...
Báo cáo khoa học: "Grounded Language Modeling for Automatic Speech Recognition of Sports Video" doc
... with traditional unigram, bigram, and trigram lan-
guage models generated from a combination of the
closed captioning transcripts of all training games
and data from the switchboard corpus ... unlabeled games are used to
train unigram, bigram, and trigram grounded lan-
guage models. Only unigrams, bigrams, and tri-
grams that are not proper names, appear greater
than three times, an...
Báo cáo khoa học: "Robust Word Sense Translation by EM Learning of Frame Semantics" docx
... the
translation process of a statistical machine trans-
lation system. Manual inspection of the contras-
tive error analysis data from a state -of- the-art
SMT system showed that around 20% of the ... translation results are more accurate.
5 Towards Translation Disambiguation
using Frame Semantics
As translation disambiguation forms the core of
various machine translation st...