Báo cáo khoa học: "F-FDG PET/CT-based gross tumor volume definition for radiotherapy in head and neck Cancer: a correlation study between suitable uptake value threshold and tumor parameters" pdf

... al.: 18 F-FDG PET/CT-based gross tumor volume definition for radiotherapy in head and neck Cancer: a correlation study between suitable uptake value threshold and tumor parameters. Radiation Oncology ... volume definition for radiotherapy in head and neck Cancer: a correlation study between suitable uptake value thre...

Ngày tải lên: 09/08/2014, 09:20

... Shrivastava SK, Mahantshetty U, Engineer R, Deshpande DD, Jamema SV, Vanetti E, Clivio A, Nicolini G, Fogliata A: A treatment planning study comparing volumetric arc modulation with RapidArc and ... Switzerland. Authors’ contributions MS and AF coordinated the entire study. Patient accrual and clinical data collection was done by MS, SC, CB, MB, PN, SP. Data analysis, physics dat...

Ngày tải lên: 09/08/2014, 09:20

... Hinke A, Louvet C: Increased survival using platinum analog combined with gemcitabine as compared to single- agent gemcitabine in advanced pancreatic cancer: pooled analysis of two randomized trials, ... gemcitabine and radiotherapy for locally advanced pancreatic cancer. IntJPancreatol 2001, 29(1):9-18. 21. Eppinga W, Lagerwaard F, Verbakel W, Slotman B, Senan S: Volumetric modula...

Ngày tải lên: 09/08/2014, 09:20

... of an internal malignancy is rare, with an incidence of 2.9-9%[1,2]. The frequencies of skin metastases in females are 69% for breast cancer, 9% for colon cancer, and 5% for melanoma. In males the ... typically an asymptomatic enlarged testicle. The retroperitoneum is the most common metastatic area. Other metastatic sites include the lung, liver, brain, adrenal glands, gastrointe...

Ngày tải lên: 09/08/2014, 03:21

... IL-1alpha protein production in human and animal cancer cell lines including sarcomas and ovarian and transitional cell carcinomas. The exact mechanisms by which IL-1 promotes tumor growth remain ... remaining of the intraperitoneal fluid was col- lected to determine intraabdominal viable tumor cells (in T1 and T4). The volume of the removed material was 30 ml in all measur...

Ngày tải lên: 09/08/2014, 04:21

... All images were e valuated by two clinicians at least. A radiologist who specialized in head and neck cancer participated when the outline of tumor margin was unclear. Radiotherapy An intensity-modulated ... at high frequency in Southern China, Hong Kong, Taiwan, Singapore, and Malaysia [1]. Radiotherapy has long been the standard treatment for patients with NPC because...

Ngày tải lên: 09/08/2014, 08:22

... Fast exact infer- ence with a factored model for natural language pars- ing. Advances in neural information processing sys- tems, pages 3–10. D. McClosky and E. Charniak. 2008. Self-training for biomedical ... Journal of biomedical informatics, 34(5):301–310. A. B. Clegg and A. J. Shepherd. 2007. Benchmark- ing natural-language parsers for biological applica- tions using depen...

Ngày tải lên: 20/02/2014, 04:20

... Takashi Osaka, Reiko Sakamoto, Akinori Tokunaga, Yuhki Nakatake, Mitsuharu Sato and Nobuaki Yoshida Laboratory of Developmental Genetics, Center for Experimental Medicine and Systems Biology, Institute ... FAC- SCalibur (Becton Dickinson, Franklin Lakes, NJ, USA) and flowjo software (TreeStar, Ashland, OR, USA). Mice and teratoma formation C57BL ⁄ 6J mice and MCH:ICR mice were pur...

Ngày tải lên: 07/03/2014, 00:20

... colorectal tumors on mitogen-activated protein ⁄ extracellular signal-regulated kinase kinase ⁄ extracellular signal- regulated kinase and nuclear factor kappaB pathway and cellular transformation. Cancer ... system. PKA may activate the Ca 2+ L-type channel, resulting in an increase in the Ca 2+ in ux, elevation of the intracellular Ca 2+ level and CaMK II activation. A generali...

Ngày tải lên: 07/03/2014, 11:20

... for mutagenesis were as follows: LmS12 2A (F), CTTGGCTGCTTGCGAGCTGTTATTCT TTTCAATCC; LmS12 2A (R), GGATTGAAAAGAATAA CAGCTCGCAAGCAGCCAAG; LmA105S (F), TTGACA GAACTGGTATCAAAGATGAGAGAAATG; LmA105S (R), ... CTCGAGAACCATGGAAGA CGCCAAAAACATAAAG; KZKLUC1 (F), CTCGAGAA CAATGGAAGACGCCAAAAACATAAAG. The bold letters in the primers show Kozak sequence. The luciferase reporter gene with the Kozak se...

Ngày tải lên: 15/03/2014, 23:20