Báo cáo khoa học: "MicroRNA expression after ionizing radiation in human endothelial cells" ppt

... effect of HSF4 on chromatin. In the absence of HSF4, histone H3K9 methylation is induced and HSF1 binding is reduced, indicating that HSF4 facilitates HSF1 binding via chromatin remodelling. Heat shock ... 4151 113 Trinklein ND, Chen WC, Kingston RE & Myers RM (2004) Transcriptional regulation and binding of heat shock factor 1 and heat shock factor 2 to 32 huma...

Ngày tải lên: 18/02/2014, 04:20

... TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan probe 18S TGGACCGGCGCAAGACGGAC AB Fig. ... Journal compilation ê 2007 FEBS 839 Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxyla...

Ngày tải lên: 19/02/2014, 02:20

... Computational Linguistics Automated Vocabulary Acquisition and Interpretation in Multimodal Conversational Systems Yi Liu Joyce Y. Chai Rong Jin Department of Computer Science and Engineering Michigan ... 1995) and recent investigations on computa- tional models for language acquisition and ground- ing (Siskind, 1995; Roy and Pentland, 2002; Yu and Ballard, 2004), we...

Ngày tải lên: 20/02/2014, 12:20

... level of Mcm expression in HeLa cells and cancer cells from human uterine cervix. Although it remains to be determined how enhanced expression of Mcm proteins affects DNA replication in cancer cells, ... in cancer cells derived from uterine cervix and in HeLa cells. The expression of Mcm genes in growth-arrested cells is induced b...

Ngày tải lên: 20/02/2014, 23:20

... image. Ó FEBS 2003 Role of cleavage and shedding in TSHR function (Eur. J. Biochem. 270) 3491 Role of cleavage and shedding in human thyrotropin receptor function and trafficking Myle ` ne Quellari 1 , ... cleavage and shedding on the one hand, and the receptor activated by the ligand on the other hand. Cleavage and shedding of a recept...

Ngày tải lên: 21/02/2014, 00:20

... epitopes and signaling mechanisms that control tumor cell and cardiomyocyte viability, but also to exploit this epitope as a novel potential thera- peutic target to mitigate anti -ErbB2- associated cardio- toxicity ... ELISAs [11], all of the available mAbs against ErbB2, such as Herceptin (trastuzumab), 2c4 (pertuzumab), 7c2, and MAB74, recognize different epitopes from that of EDIAs....

Ngày tải lên: 06/03/2014, 00:21

... 847 MINIREVIEW Alternative splicing: role of pseudoexons in human disease and potential therapeutic strategies Ashish Dhir and Emanuele Buratti International Centre for Genetic Engineering and ... the development of novel splicing-based therapeutic agents to treat HIV-1 infections [73]; and new methods in the global analysis of alternative splicing pro...

Ngày tải lên: 06/03/2014, 09:22

... using primers (5Â-CGTCAAGGAGAAAAAAC CCCGGATCTAAAA AATGGAGC AGAAA CTCATCTC TGAAGAGGATCTG -3Â) and (5Â- GCATGC CTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3Â), and checked for the presence and ... (5Â-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3Â); for OR17-40 (5Â-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3Â) and (5Â-GCATG CCTGCAGGTCGACTCTAGAGGATCT...

Ngày tải lên: 07/03/2014, 16:20

... Sialidase expression in monocytes macrophages FEBS Journal 272 (2005) 25452556 ê 2005 FEBS 2553 Differential expression of endogenous sialidases of human monocytes during cellular differentiation into macrophages Nicholas ... either monocytes or macrophages. Results Differentiation of monocytes into macrophages results in increased expression...

Ngày tải lên: 16/03/2014, 19:20

... overexpression or inhibition were determined in functional assays incl uding clonogenic assays with and without radiation in order to examine if the altered miRNA levels affected EC response to radiation. Methods Cell ... expression. Moreover, and in line with these functional findings, miR-189 up-regulation s eems to exert protective effects against radiat ion with an attenuation...

Ngày tải lên: 09/08/2014, 08:23

... response in vivo in C. elegans and in vitro in human breast cancer cells. Oncogene 2009, 28:2419-2424. 12. Maes OC, An J, Sarojini H, Wu HL, Wang E: Changes in MicroRNA Expression Patterns in Human ... Open Access MicroRNA expression profiles in human cancer cells after ionizing radiation Olivier M Niemoeller * , Maximilian Niyazi, Stefanie Corradini, Fran...

Ngày tải lên: 09/08/2014, 09:20

... per- formed and a residual renal bed abscess was found. A pigtail catheter was inserted and daily aspiration and antibiotic instillation were performed. A week later he was discharged again, with oral antibiotics. About ... Pediatric Cardiology, Madras Medical Mission, Chennai, India. Authors’ contributions AM and PK analyzed and interpreted the patient data regarding the renal di...

Ngày tải lên: 11/08/2014, 00:22

... pro-inflammatory cytokines, although TNF-a production by endothelial cells is nor- mally only induced by inflammatory stimuli such as LPS or interleukin 1b [33,34]. In the future it would be inter- esting ... and increased endothelial permeability, resembling known responses to TNF- a . Conclusions: These results indicate that CD73 normally suppresses pro-inflammatory responses...

Ngày tải lên: 11/08/2014, 08:22

... an aminotransferase class-V motif and alignment analysis showed the location of a cysteineintheactivesiteandahistidineandalaninein the cofactor binding site (Additional files 1 and 2). To find ... proteins of the [Fe-S] cluster biosynthesis pathway, i.e. altering the expression of cysteine desulfurase genes. Stress dependent changes in gene expression occur in the cytoplasm a...

Ngày tải lên: 11/08/2014, 11:21

... transcripts in soybean mature pollen Using the soybean GeneChip đ , we compared the tran- script profiles of soybean pollen with that of sporophytic tissues consisting of an equal mix of RNA derived ... [52]. Conclusion This is the first report on transcriptional profiling of the pollen of a major legume crop. The current knowledge from pollen transcriptome profiling w...

Ngày tải lên: 12/08/2014, 03:20